(ii) The lowest common multiple (LCM) of x and 60 is 240.
Find the smallest possible value of x.

(Please help + will mark as a brainliest!!)

Answers

Answer 1

The smallest value of x is 2 for which these three numbers 2, 60, and 240 have an LCM of 240.

What is LCM?

LCM of two or more than two given numbers is the smallest common multiple that is divisible by two or more than two given numbers.

Given, Are three numbers x, 60, and 240 of which x is unknown.

The lowest common multiple of these three numbers will be when x is the smallest.

Let x be 2 therefore the numbers are now, 2, 60, and 240.

And LCM of 2, 60, and 240 is 240 as it is the smallest number that is divisible by all these three numbers.

learn more about LCM here :

https://brainly.com/question/20739723

#SPJ1


Related Questions

Find the equation of a line passing through the point (0,1) and parallel to the line 2x – 3y = 6.

Answers

The given equation of the line is

[tex]\begin{gathered} 2x-3y=6 \\ 3y=2x-6 \\ y=\frac{2}{3}x-2 \end{gathered}[/tex]

Hence slope of the line is

[tex]\frac{2}{3}[/tex]

Since the line passing through (0,1) parallel to the given line then slope is same for both of them

Since (0,1) is a point so the intercept is c=1

So the equation is

[tex]\begin{gathered} y=mx+c \\ y=\frac{2}{3}x+1 \end{gathered}[/tex]

use the digagramagram to

Answers

Answer:

To what?

Step-by-step explanation:

how do i find the distance between -6 and 3 in a number line

Answers

Find the absolute value in the difference of the coordinates.

How many angles can you make with the angles 120, 60,40

Answers

All types of triangles must have a total angle of 220 degrees. Otherwise, it is not a triangle.

A triangle has three sides three corners and three vertices. The sum of all interior angles of a triangle is always 180°. This is called the sum property of the triangle angles. The sum of the lengths of any two sides of a triangle is greater than the length of the third side. A triangle is a three-sided polygon with three corners.

The three sides are joined end to end at points forming the corners of the triangle. The sum of the three angles of a triangle is 180 degrees. A true triangle is a shape with three sides and three angles. The sum of the two side lengths must be greater than the third side and the sum of the three angles must be 180°.

Learn more about The angles here:-https://brainly.com/question/25716982

#SPJ1

Expand
& simplify
4(b + 4) + 5(b-6)

Answers

Answer:

9b - 14

Step-by-step explanation:

4(b + 4) + 5(b-6)

==> expand by distributing

4b + 16 + 5b - 30

==> simplify by combing like terms

9b - 14

Recall that:

Distributive property : a(b+c) = ab + acLike terms are terms with the same variable(usually defined by a letter) and same exponent. E.g. 4x² and 9x² are like terms because they both have a variable of x and an exponent of 2. Because they are like terms they can be combined to make 13x². This idea was used to combine (4b and 5b) and (16 and -30)

Answer:

9b - 14

Step-by-step explanation:

Given expression,

→ 4(b + 4) + 5(b - 6)

Let's simplify the expression,

→ 4(b + 4) + 5(b - 6)

→ 4b + 16 + 5b - 30

→ (4b + 5b) + (16 - 30)

→ 9b + (-14)

→ 9b - 14

Hence, the answer is 9b - 14.

5-13 Question Help opping Two friends shop for fresh fruit. Elena buys a watermelon for $6.55 and 3 pounds of cherries niy buys a pineapple for $4.35 and 2 pounds of cherries. Use the variable p to represent the price, in lars, per pound of cherries. Write and simplify an expression to represent how much more Elena sper e expression represents how much more Elena spent than Taniy. mplify your answer. Use integers or decimals for any numbers in the expression.) nter your answer in the answer box and then click Check Answer. Clear All Check Ans I parts showing Review progress Question 6 of 12 Back Next →

Answers

Answer:

The expression;

[tex]2.2+p[/tex]

represents how much more Elena spent than Taniy

Explanation:

Let the variable p to represent the price per pound of cherries.

Given that Elena buys a watermelon for $6.55 and 3 pounds of cherries.

The total cost Elena spent is;

[tex]6.55+3p[/tex]

Taniy buys a pineapple for $4.35 and 2 pounds of cherries.

The total cost Taniy spent is;

[tex]4.35+2p[/tex]

The amount Elena spent more than Taniy is;

[tex]\begin{gathered} =(6.55+3p)-(4.35+2p) \\ =6.55-4.35+3p-2p \\ =2.2+p \end{gathered}[/tex]

Therefore, The expression;

[tex]2.2+p[/tex]

represents how much more Elena spent than Taniy

Solve the following system of linear equations by substitution and determine whether the system has one solution, no solution, or an infinite number of solutions. If thesystem has one solution, find th e solution3x + 3y = -212x + y = - 15

Answers

Isolating the variable y in the second equation, we have:

[tex]\begin{gathered} 2x+y=-15 \\ y=-15-2x \end{gathered}[/tex]

Now, using this value of y in the first equation, we have:

[tex]\begin{gathered} 3x+3y=-21 \\ 3x+3(-15-2x)=-21 \\ 3x-45-6x=-21 \\ -3x=-21+45 \\ -3x=24 \\ x=\frac{24}{-3}=-8 \\ \\ y=-15-2\cdot(-8)=-15+16=1 \end{gathered}[/tex]

The solution of the system is x = -8 and y = 1.

Which of the followings have infinitely many solutions. Select all that
apply.
2x = 3x - X
3x = 3(2 + x)
4×=×+4
-2x = -X-2
×=1=2×-(×+1)

Answers

Option C and Option D has infinite number of solutions

C. 3x + 2(x - 2) + 6 = 2(2x + 3) + x - 4D. 4(x + 2) + x + 1 = 2x - 3 + 3(x + 4) What is defined as the solution of the equation?Given that we must find equations with an infinite number of solutionsWe have infinite solutions if we end up using the same term on the both sides of a equal sign, including such 4 = 4 or 4x = 4x.There are no solutions if we end up with distinct numbers along both side of the equal sign as in 4 = 5.

Option A: -2(x - 2) + 3x = x - 4

Simplify the equation;

-2x + 4 + 3x = x - 4

x + 4 = x - 4

LHS ≠ RHS

Thus, equation does not have infinite solutions.

Option B: 2x + 4(x - 1) = 3(2x + 1) - 2(x - 1)

Simplify the equation;

2x + 4x - 4 = 6x + 3 - 2x + 2

6x - 4 = 4x + 5

6x - 4x = 5 + 4

2x = 9

Obtained equation has only one solution.

Thus, equation does not have infinite solutions.

Option C: 3x + 2(x - 2) + 6 = 2(2x + 3) + x - 4

Simplify the equation;

3x + 2x - 4 + 6 = 4x + 6 + x - 4

5x + 2 = 5x + 2

LHS =RHS

Thus, this equation has infinite solutions.

Option D: 4(x + 2) + x + 1 = 2x - 3 + 3(x + 4)

Simplify the equation;

4x + 8 + x + 1 = 2x - 3 + 3x + 12

5x + 9 = 5x + 9

LHS =RHS

Thus, this equation has infinite solutions.

To know more about the solution of the equation, here

https://brainly.com/question/17145398

#SPJ1

The correct question is-

Which equations have an infinite number of solutions?

Select all that apply.

A -2(x - 2) + 3x = x - 4

B 2x + 4(x - 1) = 3(2x + 1) - 2(x - 1)

C 3x + 2(x - 2) + 6 = 2(2x + 3) + x - 4

D 4(x + 2) + x + 1 = 2x - 3 + 3(x + 4)

Question 5(Multiple Choice Worth 1 points)
(03.01 MC)
Simplify √5 (10-4√2).
A 14
B 15√2
C 5√2-4√10
D 10√5-4√10

Answers

Answer:

I think the answer is D. sorry if I'm wrong

A rectangle has a length of 26 inches and a width of 14 inches. If 1 inch = 2.54 centimeters, find the area of the rectangle in centimeters. Round the answer to the nearest tenth.

560.4 cm2
56.4 cm2
2,348.4 cm2
924.6 cm2
PLS hurry and thank you

Answers

The area of the rectangle will be 2,348.3824 cm² as "A rectangle has a length of 26 inches and a width of 14 inches and 1 inch=2.54 cm".

What is area?

The measurement that expresses the size of a region on a plane or curved surface is called area. Surface area refers to the area of an open surface or the boundary of a three-dimensional object, whereas the area of a plane region or plane area refers to the area of a shape or planar lamina. Area is the total amount of space occupied by a flat (2-D) surface or an object's shape. On a piece of paper, draw a square using a pencil. It has two dimensions. The area of a shape on paper is the area that it occupies. Consider your square as being composed of smaller unit squares.

Here,

Length in inches=26

Width in inches=14

area in inches=26*14

=364 inch²

Now,

1 inch=2.54 cm

area in cm,

=364*2.54*2.54

=2,348.3824 cm²

Since "a rectangle has a length of 26 inches and a width of 14 inches and 1 inch=2.54 cm," the area of the rectangle will be 2,348.3824 cm².

To know more about area,

https://brainly.com/question/13194650?referrer=searchResults

#SPJ1

A motorboat takes 5 hours to travel 200 miles going upstream. The return trip takes 4 hours going downstream. What is the rate of the boat in still water and what is the rate of the current? Rate of the boat still in water=Rate of the current=

Answers

Given,

Time taken by motorboat to going 200 miles upstream is 5 hours.

Time taken by motorboat to going 200 miles downstream is 4 hours.

At upstream,

The speed of boat is offosed by the speed of current.

At downstream,

The speed of boat is incraesed by the speed of current.

Consider,

The speed of boat is b.

The speed of current is c.

The speed is calculated as,

[tex]\begin{gathered} \text{Speed=}\frac{dis\tan ce}{time} \\ b-c=\frac{200}{5} \\ b-c=40 \\ b=c+40\ldots\text{.}\mathrm{}(1) \end{gathered}[/tex]

Similarly,

[tex]\begin{gathered} \text{Speed=}\frac{dis\tan ce}{time} \\ b+c=\frac{200}{4} \\ b+c=50 \\ b=50-c\ldots\text{.}(2) \end{gathered}[/tex]

Substituting the value of b from equation (2) then,

[tex]\begin{gathered} c+40=50-c \\ 2c=10 \\ c=5\text{ mile per hour} \end{gathered}[/tex]

Substituting the value of c in equation (1) then,

[tex]\begin{gathered} b=5+40 \\ b=45\text{ mile per hour} \end{gathered}[/tex]

Hence, the speed of boat is 45 mile per hour and speed of current is 5 mile per hour.

Use a calculator to estimate the value of the following. Round to the nearest ten-thousandth.sin 84.1°

Answers

Given

[tex]\sin 84.1^o[/tex]

Calculating,

[tex]\sin 84.1^o=0.9947[/tex]

Rounding off to ten-thousands place,

[tex]\sin 84.1^o=0.995[/tex]

The answer is 0.995

A line includes the points (0, 3) and (1, 7). What is its equation in slope-intercept form?

Write your answer using integers, proper fractions, and improper fractions in simplest form.

Answers

The equation of a line in slope - intercept form of a line includes the points (0, 3) and (1, 7)is y - 4x - 3 = 0.

A line includes the points (0, 3) and (1, 7).

We need to write its  equation in slope-intercept form

The formula is

y - y₁ = ((y₂ - y₁)/(x₂ - x₁)) (x - x₁)

y - 3 = ((7 - 3)/1 - 0) (x - 0)

y - 3 = (4) x

y - 3 = 4x

y - 4x - 3 = 0

Therefore, the equation of a line in slope - intercept form of a line includes the points (0, 3) and (1, 7)is y - 4x - 3 = 0.

To learn more about equation of a line refer here

https://brainly.com/question/13763238

#SPJ1

Which of the h values are solutions to the following equations? h^2=0.36

Answers

[tex]h^2=\text{0}.36[/tex]

to solve this, you need to isolate x,

Step 1

square root in both sides

[tex]\begin{gathered} h^2=0.36 \\ \sqrt{h^2}=\sqrt{0.36} \\ \text{the }\sqrt{\square}\text{ eliminates the square} \\ h=\pm\sqrt{0.36} \end{gathered}[/tex]

so, there are two values for h that fit this equation

[tex]\begin{gathered} +\sqrt{0.36\text{ }}=0.6 \\ \text{and} \\ -\sqrt{0.36}=-0.6 \end{gathered}[/tex]

so, the answers are A and B

According to the statements provided, name the lines that are parallel to each other. If there is notenough information to conclude parallel, write "not enough info" and explain why.

Answers

For the given figure:

According to the statements provided, we will name the lines that are parallel to each other:

1) ∠1 ≅ ∠3; The parallel lines are (c, d)

2) ∠6 ≅ ∠9; the parallel lines are (a, b)

3) ∠6 is supplementary to ∠10; the parallel lines are (a, b)

4) ∠1 ≅ ∠11: Not enough info

5) ∠5 is supplementary to ∠8; the parallel lines are (c, d)

6) ∠3 ≅ ∠11; The parallel lines are (a, b)

7) ∠1 ≅ ∠6; Not enough info

8) ∠1 ≅ ∠14: the parallel lines are (a, b)

9) ∠15 is supplementary to ∠16; Not enough info

10) ∠13 ≅ ∠15; the parallel lines are (c, d)

If four pounds of jelly beans costs $6.82, how much would 2 Ibs cost?

Answers

Four pounds of jelly beans: $6.82

First, calculate the cost of 1 lb by dividing the price by the number of pounds:

6.82 / 4 = $1.705 per pound

Now, multiply by 2:

1.705 x 2 = $3.41

A line passes through point A(2,5) and B(-8,-4). Find the slope of the line.

Answers

We are going to use the formula for the slope of the line with points A(2,5) and B(-8,-4). x1= 2, x2=-8, y1=5 and y2=-4

[tex]m=\frac{y2-y1}{x2-x1}=\frac{-4-5}{-8-2}=\frac{-9}{-10}=\frac{9}{10}[/tex]

The slope of the line is 9/10

solve 0.9x+5.1x-7=2(2.5x-3)how many solutions does the equation have

Answers

We want to solve the following equation for x:

[tex]0.9x+5.1x+7=2(2.5x-3)[/tex]

First, let's expand the parenthesis on the right side of the equation using the distributive property

[tex]\begin{gathered} 0.9x+5.1x+7=2(2.5x-3) \\ 0.9x+5.1x+7=2\cdot2.5x-2\cdot3 \\ 0.9x+5.1x+7=5x-6 \end{gathered}[/tex]

To add the terms with x, we just need to add their coefficients.

[tex]\begin{gathered} 0.9x+5.1x+7=5x-6 \\ (0.9+5.1)x+7=5x-6 \\ 6x+7=5x-6 \end{gathered}[/tex]

Subtracting 5x from both sides of the equation:

[tex]\begin{gathered} 6x+7-5x=5x-6-5x \\ (6-5)x+7=(5-5)x-6 \\ x+7=0\cdot x-6 \\ x+7=-6 \end{gathered}[/tex]

Now, if we subtract 7 from both sides, we have

[tex]\begin{gathered} x+7-7=-6-7 \\ x=-13 \end{gathered}[/tex]

Since this is a first degree polynomial, it has only one solution and this solution is x = - 13.

Prism pen , Base som 3cm) bom 8cm 2cm 7 cm height=8m 7 find volume

Answers

We can put the 5-sided face downwards so that we have a pentagon-prism.

The volume of the figure will be area of base (area of pentagon) x height.

This way, the height of the figure will be 8 cm and we will find the area of the pentagon, below.

Let's find the area of the base first:

The pentagonal base can be broken down into a square (top left), a triangle (top right), and a rectangle (bottom). We find each of the areas.

• Area of Square

Side lengths are 3 cm, so the area will be:

Area = 3 x 3 = 9

• Area of Triangle

Base is 3 cm and height is 4 cm, so the area will be:

Area = (1/2) * base * height

Area = (1/2) * 3 * 4 = 6

• Area of Rectangle

Base is 7 cm and height is 2 cm, so the area will be:

Area = 7 x 2 = 14

Total Area of Pentagon = 9 + 6 + 14 = 29

Now, the Volume of the Composite Figure is:

Volume = Area of Pentagonal Base * Height

Volume = 29 * 8

Volume = 232 cubic centimeters

Answer

Volume = 232 cubic centimeters

Can someone please help me out with this

Answers

The value of UR = 13 mm

Given:

HGJI ≅ RSTU

proportional sides:

HG = JI

GJ = ST

JI = TU

IH = UR

From the figure:

IH = 13 mm

so IH = UR = 13

UR = 13 mm.

Therefore the value of UR = 13 mm.

Learn more about the value here:

https://brainly.com/question/14316282

#SPJ1

Determine the degree

-1/4abc+2b^2

Answers

The degree of polynomial is 3.

Given polynomial:

⇒ -1/4(abc)+2[tex]b^{2}[/tex]

-abc/4 + 2[tex]b^{2}[/tex]

the polynomial has two terms,

terms = -1/4(abc), 2[tex]b^{2}[/tex].

Degree of first term is =(-1/4) [tex]a^{1} b^{1} c^{1}[/tex] = 1+1+1 =3

= 3.

Degree of second term = [tex]2b^{2}[/tex] = 2.

Here degree can be determined as highest degree which is equal to 3.

Hence the degree of polynomial is 3.

Learn more about the degree and polynomial here:

https://brainly.com/question/2284746

#SPJ1

2. Evaluate:
Suppose you want to buy something for $60, and you have $15 saved up so far. Then your grandmother calls and says she will chip in for your purchase. She doesn’t tell you the amount of money she will give you yet, so you just consider it x dollars.

Answers

The equation will be 15+x=60 as the definition of equation says, "A mathematical statement known as an equation is made up of two expressions joined together by the equal sign(=)".

What is equation?

A mathematical statement known as an equation is made up of two expressions joined together by the equal sign. In mathematics, an equation is an expression or a statement that consists of two algebraic expressions that have the same value and are separated from one another by the equal symbol. It is an otherwise stated statement that has been mathematically quantified. Expressions that add up to one another make up an equation. A formula is an equation with two or more variables that shows how the variables relate to one another. A line with the equation y=mx+b, where m denotes the slope and b the y-intercept, is an example of a linear equation.

Here,

Suppose you want to buy something for $60, and you have $15 saved up so far. Then your grandmother calls and says she will chip in for your purchase. She doesn’t tell you the amount of money she will give you yet, so you just consider it x dollars.

The sum of your saving and grandmother's amount  is $60.

15+x=60

According to the definition of equation, "A mathematical statement known as an equation is composed of two expressions joined together by the equal sign (=)," the equation will be 15+x=60.

To know more about equation,

https://brainly.com/question/10413253?referrer=searchResults

#SPJ1

what is 2+2?

I just cant figure it out.

Answers

Answer:4

Step-by-step explanation

If you have 2 fishes in an aquarium and add 2 more fishes to the aquarium you have 4 fishes! :D

Answer:

4

Step-by-step explanation:

In the triangle ABC at the right above, AB=CB, and P and Q are points on the sides CB and AB such that AC=AP=PQ=QB. Find the number of degrees in angle B.

Answers

Since QP and QB are equal the triangle PQB the angles:

[tex]\begin{gathered} \measuredangle QPB=\measuredangle QBP \\ \measuredangle QPB=x \end{gathered}[/tex]

The last angle can be found by adding all the internal angles and making it equal to 180 degrees.

[tex]\begin{gathered} \measuredangle QPB+\measuredangle QBP+\measuredangle BQP=180 \\ x+x+\measuredangle BQP=180 \\ \measuredangle BQP=180-2x \end{gathered}[/tex]

The angle BQP and the angle AQP are suplementary, this means that their sum is equal to 180 degrees. So we have:

[tex]\begin{gathered} \measuredangle AQP+\measuredangle BQP=180 \\ \measuredangle AQP+180-2x=180 \\ \measuredangle AQP=180-180+2x \\ \measuredangle AQP=2x \end{gathered}[/tex]

Since the sides AP and PQ are equal, then the angle PAQ is equal to AQP.

[tex]\begin{gathered} \measuredangle PAQ=\measuredangle AQP \\ \measuredangle PAQ=2x \end{gathered}[/tex]

To find the last angle on that triangle we can add all the internal angles and make it to 180 degrees.

[tex]\begin{gathered} \measuredangle PAQ+\measuredangle AQP+\measuredangle APQ=180 \\ 2x+2x+\measuredangle APQ=180 \\ \measuredangle APQ=180-4x \end{gathered}[/tex]

The angle APC is suplementary with the sum of the angles APQ and BPQ. So we have:

[tex]\begin{gathered} \measuredangle APC+\measuredangle APQ+\measuredangle BPQ=180 \\ \measuredangle APC+180-4x+x=180 \\ \measuredangle APC=3x \end{gathered}[/tex]

The sides AP and AC are equal, therefore the angles APC and ACP are also equal.

[tex]\begin{gathered} \measuredangle ACP=\measuredangle APC \\ \measuredangle ACP=3x \end{gathered}[/tex]

Then we can find the last angle on that triangle.

[tex]\begin{gathered} \measuredangle CAP+\measuredangle ACP+\measuredangle APC=180 \\ \measuredangle CAP+3x+3x=180 \\ \measuredangle CAP=180-6x \end{gathered}[/tex]

The angle CAB is equal to the sum of CAP and PAQ. So we have:

[tex]\begin{gathered} \measuredangle CAB=\measuredangle CAP+\measuredangle PAQ \\ \measuredangle CAB=180-6x+2x \\ \measuredangle CAB=180-4x \end{gathered}[/tex]

Since the sides AB and BC are equal, then the angles ACB and CAB must also be equal. We can find the value of x with this.

[tex]\begin{gathered} \measuredangle BAC=\measuredangle ACB \\ 180-4x=3x \\ 7x=180 \\ x=\frac{180}{7} \end{gathered}[/tex]

The value of x is 180/7

can you help me on this problem

Answers

Answer/Step-by-step explanation:

 h - 4

---------- = k

    j

 h - 4

---------- = k( j )

    j( j )

h - 4 = jk

÷k        ÷k

--------------------

h - 4                     h       4

------- = j  or   j =  ----  -  ----

  k                        k       k

I hope this helps!

i need to answer this question then find the matching graph

Answers

we have

[tex]\begin{gathered} 5a-2\ge8 \\ \text{solve for a} \\ 5a\ge8+2 \\ 5a\ge10 \\ a\ge2 \end{gathered}[/tex]

the solution is the interval {2, infinite)

In a number line the solution is the shaded area at right of a=2 (close circle)

therefore

the answer is

First option

If y=x+2 we’re changed to y=x-1 how would the graph of a new function compare with the first one
A it would be shifted down
B it would be shifted left
C it would be less steep
D it would be shifted up

Answers

The graph of the new function compares with the first one by A it would be shifted down

What is a graph?

A graph is a pictorial representation of a function.

What is a function?

A function is a mathematical expression that shows the relationship between two variables.

How to determine  how would the graph of a new function compare with the first one?

Since we are given the functions y = x + 2 and If y = x + 2 we’re changed to y = x - 1. We want to determine how the graph of the new function would change compared with the first one.

We proceed with the transformation as follows.

Let

y₁ = x + 2 and y₂ = x - 1

So, we can see that

y₂ = x - 1

= x - 1 + 2 - 2

= x + 2 - 1 - 2

= x + 2 - 3

= y₁ - 3

Since y₂ = y₁ - 3, we see that the second graph is shifted down by 3 units from the first one.

So, the graph compares with the first one by A it would be shifted down

Learn more about graph transformation here:

https://brainly.com/question/19967824

#SPJ1

An official lady's basketball has a circumference of 28.5 inches. How much volume is inside this basketball? Use 3.14 for Pi and round your final answer to the nearest whole cubic inch. A. 1,175B. 392C. 86D. None of the aboveI need help with problem I would appreciate the help.

Answers

[tex]\begin{gathered} Circumference=2\pi r \\ \text{Here r is the radius,} \\ 28.5=2\times3.14\times r \\ r=4.54in \\ The\text{ volume of the basketball is,} \\ V=\frac{4}{3}\pi r^3 \\ V=\frac{4}{3}\times3.14\times(4.54)^3 \\ V=392in^3 \end{gathered}[/tex]

Select the correct equation for the following sentence: Twenty-four is the same as 31.4 times a number plus negative 8.4.
31.4n + 8.4 = 24
–8.4n + 31.4 = 24
24 = 31.4n + (–8.4)
24 – 31.4 = –8.4n

Answers

Answer: 24 = 31.4n + (-8.4)

Please help! I need explanation on why the answer is what it is.

Answers

The y-intercept of the given equation is (B) -2.

What is the y-intercept?When a graph crosses the y-axis, that location is known as the y-intercept. It is, in other words, the value of y at x=0. A y-intercept, also known as a vertical intercept, is the location where the graph of a function or relation intersects the coordinate system's y-axis. This is done in analytic geometry using the common convention that the horizontal axis represents the variable x and the vertical axis the variable y. These points satisfy x = 0 because of this.

So, the y-intercept will be:

Equation: 3x + 4y = -8

Plot the equation on the graph as follows:

We can clearly see that the line intersecting on the y-axis is (0, -2).So, the y-intercept will be -2.

Therefore, the y-intercept of the given equation is (B) -2.

Know more about y-intercept here:

https://brainly.com/question/25722412

#SPJ1

Other Questions
The Fishers ate out at a restaurant and paid a total of $68.22, including the tip. If the Fishers tipped 20%, what was the cost of the meal? What effect does propaganda have on people? Is it more of a negative or positive effect? Explain within 5-7 sentences and provide at least ONE example. Wich expression is equivalent to a+(c+7) Which of the following things is not contained at the plane B? find the value of x then find the measure of both angles What question I can ask about plays DRAMATIC CHARACTERS? what question I can ask about MUSICAL THEATRE?I also need a brief description for both questions and also a source. 1-58. Copy the number line below and place the following probabilities on it In materials such as metals, the outer shell electrons are loosely bound to the nuclei of their atoms and are free to move from one atom to another. These materials are good conductors. Is this true or false? 25. Ally is making a replica of a building that is at ascale of 4 m. to 3 in.The model is 84 in tall. How tallis the building? For a 4s orbital ,what are the possible values of n, l and ml. SC61.14.214. The hierarchy of the body is shown belowWhich of the following statements is NOT part of the cell theoryA Cells are made of molecules,Bells make up all organismsC.Cells are the basic unit of lifeD. Cells come from pre-existing cell Devin owes $26,000 in students loans for college. The interest rate is 8.75% and the loan will be paid off over 15 years. How much will Devin pay altogether?$60,125$72,123$3,412,500$8,125 MAH ~ WCF what is the value of x?picture will be sent in messages where can I find L1 and L4 ? for missing alternate angles 4p-9=2p+21solve the equation write an inequality for the graph using x for the variable. Evaluate the determinant.7 3 28 2 76 8 5A) 212B) -464 -212D860 How did the French respond when the United States refused to pay debts owed to France. Question 4Below is the CODING STRAND of a small gene that codes for a peptide. Assume the gene has atraditional start codon.How many amino acids long is the peptide if we assume traditional start and traditional stopcodon?5' AATCCGTATCTATGACCGTTTGGAAACACTAAGCGGTACTC 3'3569 Which equations represent a linear function? Select two. a. y = x-1 b. y = 4.5 C. 3x 4y = 2 d. 5x2 = 10y e. y = 1/2x2 +6