Question 4
Below is the CODING STRAND of a small gene that codes for a peptide. Assume the gene has a
traditional start codon.
How many amino acids long is the peptide if we assume traditional start and traditional stop
codon?
5' AATCCGTATCTATGACCGTTTGGAAACACTAAGCGGTACTC 3'
3
5
6
9

Answers

Answer 1

Transcription is mRNA synthesis, which occurs by complementing a segment of the DNA template strand. The translation is the protein growth, which occurs by adding amino acids coded by mRNA codons. C) the polypeptide is 6 amino acids long.  

What are transcription and translation?

The whole process of protein synthesis includes Transcription and translation.

TRANSCRIPTION

Transcription is the mRNA synthesis process and occurs in the nucleus.

The DNA template strand is read in direction 3'→ 5' to build the mRNA molecule in direction 5'→ 3'. The template strand is the one that is going to be complemented by the mRNA.

mRNA molecule has the same sequence as the DNA coding strand, but it carries uracil instead of thymine.

TRANSLATION

Translation is the process through which polypeptide grows. It occurs in the cytoplasm.

rRNA and tRNA read mRNA in the direction 5'→ 3' and add the correct amino acids to build the new protein.

Amino acids are coded by mRNA codons. Protein synthesis initiates in the AUG start codon -Metionin- and ends when reaching either of the stop codons UAA, UAG, or UGA.

In the exposed example, we have a DNA strand. We know that it is the coding strand, so it has the same sequence as mRNA molecule.

DNA coding strand

5' AATCCGTATCTATGACCGTTTGGAAACACTAAGCGGTACTC 3'

mRNA molecule

5' AAUCCGUAUCUAUGACCGUUUGGAAACACUAAGCGGUACUC 3'

Kowing mRNA sequence, we can grow the protein.

So first, we need to find the initiation codon (AUG), begining from the mRNA 5' extreme. Then we need to find a stop codon (UAA, UAG, or UGA).

mRNA start codon

5' AAUCCGUAUCUAUGACCGUUUGGAAACACUAAGCGGUACUC 3'

mRNA stop codon

5' AAUCCGUAUCUAUGACCGUUUGGAAACACUAAGCGGUACUC 3'

So this protein begins in AUG and ends in UAA.

To grow the protein, we need to separate mRNA codons and find the corresponding amino acids.

mRNA codons ⇒ AUG   ACC   GUU   UGG   AAA   CAC   UAA     amino acids ⇒  Met    Thr      Val     Trp      Lys      His    Stop               Protein ⇒ Met-Thr-Val-Trp-Lys-His

According to this reasoning, the polypeptide is 6 amino acids long. Option C) is correct.

You can learn more about protein synthesis at

https://brainly.com/question/16305501

#SPJ1


Related Questions

A(n) ___ worldview puts humans above the earth.

A. planetary-management and stewardship
B. none of these
C. planetary-management
D. environmental-wisdom
E. stewardship
F. all of these

Answers

Answer: C

Explanation:

The space between the soil is part of the _________.

Answers

Answer:The space between he soil is part of the pores.

Explanation:The volume of all the pores divided by the volume of the soil profile is the porosity. Water, air and other gases move into and out of these pores. Soil-water is the water that fills part or all of the pores.

7. Cells obtain energy by either capturing light energy through photosynthesis or
by breaking down carbohydrates through cellular respiration. In both
photosynthesis and cellular respiration, the energy is ultimately derived from the
Sun in a
O A. reversible process.
O B. highly efficient process which involves no loss of heat to the environment.
C. one-way process.
O D. pathway that involves taking in heat from the environment at each step.

Answers

In both photosynthesis and cellular respiration, the energy is ultimately derived from the Sun is a one-way process. Option C.

The plant captures mild strength and releases oxygen, that is finally ate up in cell respiration. Thus, the sun is the final supply in each the reaction. The strength is in the long run derived from the sun; this method is usually termed as a one-manner method.

Photosynthetic cells contain chlorophyll and different mild-touchy pigments that seize sun strength. In the presence of carbon dioxide, such cells are capable of convert this sun strength into strength-wealthy natural molecules, inclusive of glucose.

Through the method of cell respiration, the strength in meals is transformed into strength that may be utilized by the body's cells. During cell respiration, glucose and oxygen are transformed into carbon dioxide and water, and the strength is transferred to ATP.

Learn more about photosynthesis here https://brainly.com/question/19160081

#SPJ1

The following is a list of the events that occur during a muscle contraction. Choose the one that occurs last

1. Myosin cross-bridges bind to the actin.
2. The free myosin head splits ATP.
3. Calcium ion is released from the sarcoplasmic reticulum.
4. The myosin head pivots toward the center of the sarcomere.
5. Calcium ion binds to troponin.
6. The myosin head binds an ATP molecule and detaches from the actin.

a. 3,5, 1,4,6,2
b. 1,4,6,2,3,5
c. 3,5, 1,2,4,6
d.5, 1,4,6,2,3
e. 1,3,5,4,6,2

Answers

The answer is a) 3,5,1,4,6,2. Muscle contraction is defined as the muscle response to a stimulus that involves the interaction of the contractile proteins actin and myosin in the presence of calcium.

The correct sequence of muscle contractions is:

3. Calcium ions are released from the sarcoplasmic reticulum

5. Calcium ions binding to Troponin

1. Myosin Bridges Bind Actin

4. The myosin head pivots towards the center of the sarcomere

6. Myosin heads bind to ATP molecules and are detached from actin filaments

2. Free myosin head cleaves ATP.

The movement of muscle shortening occurs when the myosin head attaches to actin and actin is pulled inward. This action requires energy provided by ATP. Myosin binds to actin at the binding site of the globular actin protein. Myosin has another binding site for ATP where enzymatic activity hydrolyzes ATP to ADP, releasing an inorganic phosphate molecule and energy.

Learn more about muscle contraction visit: https://brainly.com/question/1990110

#SPJ4

how an atom change if all of its electrons are removed

Answers

Answer:

If all the electrons of an atom are removed, it will change to become a positively charged ion called a cation. Additionally, the loss of all of its electrons means there is no negative charge to balance the positive charges of the protons.

Explanation:

Draw a cross-section of the spinal cord and show how the three types of neurons are involved in reflex action. Make sure to show how these neurons interface with the leg. Is the brain involved in this pathway? why or why not?.

Answers

The brain is not involved in a reflex action, because reflex action is spontaneous without going through the thought process. All three types of neurons are involved in reflex action: Stimulus → receptor → sensory neuron → spinal cord → delay neuron motor neuron → effector → reflex.

How does the reflex action occur?

Reflex movements in the body occur when there is stimulation received by nerve cells or neurons in the body. Examples of these stimuli are hot temperatures or the presence of water droplets that enter the eye

The mechanism begins with a stimulus from the outside. The range will be felt by the receptors. The receptor then sends electrical impulses about what it feels on sensory neurons. Impulses are then sent through delay neurons. Delay neurons are interneurons that are in the spinal cord and connect sensory neurons to motor neurons. The delay neurons then send impulses to the motor neurons and then to the effectors to create reflexes.

Learn more about the reflex action at https://brainly.com/question/10003986

#SPJ4

Scientific researchers discovered agents that behaved like bacteria causing diseases such as rabies and hoof-and-mouth, but were much smaller. It became the general view that viruses were biologically "alive." This perception changed in 1935 when the tobacco mosaic virus was crystallized and scientists demonstrated that the particles lacked any mechanisms necessary for metabolic function. It was determined that viruses consisted of a nucleic acid, DNA or RNA, surrounded by a protein shell. Viruses exist in two distinct states. When not in contact with a host cell, the virus remains entirely dormant. During this time there are no biological activities occurring and the virus is nothing more than a static organic particle. Viruses can remain like this for extended periods of time, waiting to come into contact with the appropriate host. When the virus comes into contact with a host, it becomes active, reacts to its environment and/or host and directs its efforts toward self-replication. The viral goal now is to produce more viruses to attack host cells.

The characteristics of life: many are listed in the passage describing viruses. One important piece of evidence arguing against life for viruses is implied by the passage; not stated directly. Viruses are not living, because, as implied by the passage, they

A. Lack a nucleus
B. Have no DNA
C. Are not cellular
D. Do not reproduce

Answers

According to the given passage, viruses are not living because they (C) do not have a cellular organization.

Viruses lack a cellular organization which is a basic feature of all living organisms. A virus is a nucleoprotein, with the genetic material enclosed by a protein coat. The genetic material could be either DNA or RNA. The genetic material is responsible for causing infection in the host.

Viruses are inactive outside their specific host cell. They are non-cellular organisms. They possess an inert crystalline structure outside the living host cell. The protein coat of a virus, i.e. capsid, serves as a protective covering for the genetic material.

To learn more about capsid here

https://brainly.com/question/25030164

#SPJ1

Polyploidy is the condition in which A. a piece of a chromosome breaks off and reattaches to another chromosome. B. an organism has an extra set of chromosomes. C. a mutagen speeds the mutation rate. D. an insect develops a resistance to a pesticide.​

Answers

Answer:

B

Explanation:

it is a eatra set of it set it a chromosome that how it that

which of the following are sources of antibodies for serological testing? which of the following are sources of antibodies for serological testing? cells producing monoclonal antibodies vaccinated animals, cells producing monoclonal antibodies, and viral cultures viral cultures vaccinated animals and cells producing monoclonal antibodies vaccinated animals

Answers

Monoclonal antibodies and vaccinated animals are two sources of antibodies used in serological testing.

Which of the following is a test to see if soluble antigens are present?

It is possible to modify the agglutination test to measure soluble antigens. The term "hemagglutination inhibition" refers to this test. Hemagglutination inhibition refers to the measurement of soluble antigen's capacity to prevent antibodies from adhering to antigen-coated red blood cells.

Which antibodies are present in saliva, tears, and mucus?

IgA is the primary class of antibody present in a variety of bodily fluids, including tears, saliva, respiratory, intestinal, and colostrum secretions. IgA levels in serum are quite low. B cells found in the body's mucous membranes create IgA.

Learn more about antibodies here:

https://brainly.com/question/27931383

#SPJ4

In multicellular organisms, which term tells the highest level of cellular organization?
organs
cells
tissues
systems

Answers

Answer:

D, Systems      

would be your answer

in keeping with the scientific method, lab reports should be organized in the following sections: i. introduction ii. materials and methods iii. results iv. discussion

Answers

The sections listed below should be included in lab reports:

i. introduction ii. materials and methods  iii. discussion  iv. results

How should a biology lab report's introduction be written?

The goal of the experiment is stated in a lab report's introduction, which also gives the reader some background information. Clearly and succinctly describe the subject of your report. Provide the reader with background theory, prior research, or formulas they should be familiar with.

Which steps of the scientific method should come first?

Follow these steps to conduct an experiment: observe, ask a question, formulate a hypothesis, carry it out, gather data, analyze it, and report the findings.

To know more about scientific method visit:-

https://brainly.com/question/7508826

#SPJ4

after a meal, both insulin and glucagon are secreted into the blood stream. what is their relationship?

Answers

Together with the hormone insulin, glucagon regulates blood sugar levels and helps to maintain target ranges. Insulin is produced to prevent blood sugar levels from increasing too high (hypoglycemia) while glucagon is released to prevent blood sugar levels from falling too low  (hyperglycemia).

The pancreatic islets of Langerhans' alpha cells release the peptide hormone known as glucagon. The best-known effect of glucagon is to promote glucose synthesis in the liver and hence maintain appropriate plasma glucose concentrations. Hypoglycemia is physiologically the most powerful secretory stimulation. The metabolism of hepatic lipids and amino acids is also influenced by glucagon, which may lead to an increase in resting energy expenditure.

The INS gene in humans encodes insulin, a peptide hormone generated by beta cells of the pancreatic islets. It is regarded as the body's primary anabolic hormone.

To learn more about hypoglycemia click here,

https://brainly.com/question/14757163

#SPJ4

Based on your answer to question 1, what do you think could be done to reduce levels of carbon dioxide in the atmosphere? What could people change that would reduce the burning of fossil fuels? WILL MARK BRAINLIEST

Answers

By using fossil fuels, which releases additional carbon dioxide into the atmosphere as in form of gases such as carbon dioxide (CO₂), we are altering the carbon cycle.

What do you mean by carbon dioxide?

One carbon atom is covalently doubly linked with two oxygen atoms in each of the molecules that make up carbon dioxide. It exists in the gas state at room temperature. Carbon dioxide acts as a greenhouse gas in the atmosphere since it absorbs infrared light rays despite being transparent in the visible. Numerous health impacts from CO₂ exposure might be experienced. These symptoms can include a coma, hypoxia, convulsions, sweating, a tingling or pins-and-needles sensation, headaches, disorientation, restless, a tingling or pins-and-needles feeling, and difficulty breathing.

Where does carbon dioxide come from?

The majority of animals, which exhaust in the form of a waste product, are naturally sources of carbon dioxide. The main source of carbon dioxide emissions from human activity is energy generation, which includes coal burning, oil, or natural gas. In milliequivalents per liter (mEq/L) either millimoles per liter (mmol/L), the typical range is 23 to 29. The typical value ranges may vary a little bit between labs. The fossil fuel burning like coal, natural gas, and oil is responsible for 87 percent among all human-produced emissions of carbon dioxide. The burning of fossil fuels is the main human emission source of carbon dioxide.

To know more about Carbon Dioxide visit:

https://brainly.com/question/9630194

#SPJ1

Which answer is not a mechanism for evolution?

Answers

Random mutation is not an mechanism of evolution .

Five important factors for evolution mechanism are Natural Selection, genetic drift, gene flow, mutations, and non random mating. Through these process members of a population differs greatly in their traits.

Natural selection is the most important mechanism of evolution, other evolutionary mechanisms can also change the frequencies of traits in populations. These include mutation, genetic drift and migration. Natural selection have 5 basic and major components These are Variation (individual have variation in appearance and behavior ), Inheritance( traits are continuously passed on from parent to offspring), Selection, Time and Adaptation.

To learn more about Natural selection  , here

brainly.com/question/9830102

#SPJ1

Question 2 of 10
What is the likely effect of increasing the use of fossil fuels?
O A. Pollution levels and their effects will decrease.
B. Global warming will steadily decrease.
C. Biodiversity will decrease in most ecosystems.
D. Ecosystems will become more resilient.

Answers

It’s c because the other 3 things are good for the environment so it has to be the one that is bad

Which of the following images shows a chemical change occurring?

water condensation
© akchamczuk / iStock 2018
crushing a can
© gbrundin / iStock 2018
stretching an elastic
© emregologlu / iStock 2018
old rusted boat
Public Domain

Answers

Answer: Old rusted boat or stretching an elastic. If your good at math can you please help me and provide an explanation. Olivia has read 40 pages of a 70 page book, 60 pages of an 85 page book and 43 of a 65 page book. What is the percentage of pages Olivia has not read?

Explanation:

an erosion of the mucosa of the lower esophagus, stomach, or duodenum caused by the breakdown of gastric barriers or by excessive amounts of gastric acid is called a(n)

Answers

Ulcers are caused by the destruction of gastrointestinal barriers or by the overproduction of stomach acid.

What is the digestive process?

Ingestion, propulsion, mechanical or physical digestion, chemical digestion, absorption, and faeces are the six steps in the digestion process. Ingestion, the first of these procedures, is the process by which food enters the alimentary canal through the mouth.

Is stomach acid a barrier of any kind?

Several mucosal defence mechanisms in the stomach guard it from harmful substances including hydrochloric acid. The mucus-bicarbonate barrier makes up the pre-epithelial barrier. The pH gradient created by mucus and the bicarbonate that mucus cells release helps to keep the epithelial cell surface close to neutral.

To know more about Mucosa Erosion visit:-

https://brainly.com/question/13153021

#SPJ4

Which parts of the brain constitute the emotional brain known as the limbic system?.

Answers

The part of the brain that is the emotional brain is known as the limbic system, namely the frontal lobe.

The cerebrum is divided into 4 parts, namely:Frontal lobe: located at the front of the brain, roughly parallel to the forehead bone. This lobe controls movement, speech, behavior, memory, emotion, and personality, and plays a role in intellectual functions, such as thinking, reasoning, problem-solving, decision-making, and planning.Parietal lobe (upper): located behind the frontal lobe which controls sensations, such as touch, pressure, pain, and temperature, and also controls spatial orientation or understanding of size, shape, and direction.Temporal lobes: located on the right and left sides of the brain, near the ears. This lobe functions to control the sense of hearing, memory, and emotion, and also plays a role in the function of speech.Occipital lobe: located at the back of the brain which controls vision.

Learn more about the frontal lobe here https://brainly.com/question/19260219

#SPJ4

How is ATP is involved in making sugars in photosynthesis?

Answers

Explanation:

For plants, this is a particularly important source of ATP because ATP is also required for the first glucose synthesis process. Without a supply of ATP produced by photosynthetic processes, plants would be caught in a "catch-22" position where they would need to produce glucose in order to manufacture ATP.

When a substance changes from a liquid to a gas, what happens to the
motion of its particles?
A. They move at the same speed but in random directions:
B. They move more quickly and independently.
C. They move more slowly and are fixed in place.
OD. They move at the same speed and in the same direction.

Answers

Answer: B. They move more quickly and independently.

Explanation:

In gases the particles move rapidly in all directions, frequently colliding with each other and the side of the container. With an increase in temperature, the particles gain kinetic energy and move faster.

Which of the following correctly describes how two systems of the human body interact to carry out life processes?
A.
The excretory system takes fluids into the body, and the digestive system disposes of excess fluids.
B.
The digestive system takes oxygen into the body, and the respiratory system distributes it.
C.
The circulatory system takes fluids into the body, and the excretory system disposes of excess fluids.
D.
The respiratory system takes oxygen into the body, and the circulatory system distributes it.

Answers

Answer:

D.

The respiratory system takes oxygen into the body,and the circulatory system distributes it

When doing medical research with human subjects, which four limitations are unavoidable?

It’s often impossible to repeat trials on the same subjects.
Subjects may report an inaccurate medical history.
It can be difficult to control all possible variables.
It’s impossible to come up with testable scientific questions for human subjects.
There are ethical or privacy concerns to consider.

Answers

In medical research with human subjects, four limitations are unavoidable A, B, C, E.

What is medical research with human subjects?

An example of medical research is one that incorporates elements of biology, chemistry, and pharmacology.

The following are some restrictions on medical research using human subjects:

Trials on the same subjects can frequently not be repeated.

Subjects could give a false medical history.

Trying to manage every potential variable might be challenging.

There are ethical and privacy issues to take into account.

Therefore, human subjects include inaccurate medical histories, and repeat trials, hence option A, B, C, and E are correct.

Learn more about research, here:

https://brainly.com/question/11234474

#SPJ1

Answer:

It’s often impossible to repeat trials on the same subjects.

Subjects may report an inaccurate medical history.

It can be difficult to control all possible variables.

There are ethical or privacy concerns to consider.

Explanation:

in general, autonomic tone of peripheral blood vessels increases when in general, autonomic tone of peripheral blood vessels increases when parasympathetic stimulation is increased. sympathetic stimulation is increased. parasympathetic stimulation is decreased. somatomotor stimulation is increased. sympathetic stimulation is decreased.

Answers

In general, the autonomic tone of peripheral blood vessels increases when sympathetic stimulation is increased and parasympathetic stimulation is decreased.

How does sympathetic and parasympathetic nervous stimulation affect blood vessels?

Sympathetic nervous stimulation refers to the stimulation of the autonomic nervous system during periods of intense activities known as the flight or flight response. The sympathetic nervous stimulation prepares the body for action by increasing heart rate, increasing respiratory rate, increasing blood pressure, etc.

Parasympathetic nervous stimulation refers to the stimulation of the autonomic nervous system during periods of rest. The parasympathetic nervous stimulation returns or keeps the body at rest by decreasing heart rate, decreasing respiratory rate, decreasing blood pressure, etc.

Learn more about sympathetic and parasympathetic nervous stimulation at: https://brainly.com/question/12961611

#SPJ1

if you select for two closely related species of bacteria on media and distinguish between them through sugar fermentation, which type of medium is this?

Answers

Specific species can develop on selective media, whereas differential media are used to separate one species from another.

What is fermentation explain?

fermentation is an aerobic chemical method that breaks away molecules like glucose. More specifically, fermentation is really the foaming that happens during the creation both beer and wine. a procedure that has been around for at least 10,000 years.

What happens during fermentation?

The breakdown of carbohydrates occurs by the enzyme of microbes during fermentation in the absence of air. Microbes like bacteria and fungi are able to produce enzymes that really can break down a variety of sugar molecules because they have special metabolic genes.

To know more about fermentation visit:

brainly.com/question/13050729

#SPJ4

Parasites often play a role in maintaining the carrying capacity of an organism. Parasites are organisms that feed on or in an individual using the host organism’s resources while providing nothing in return. Parasites can best be described as which of the following?

A. producer
B. bio factor
C. abiotic factor
D. primary consumer

Answers

The correct answer is B. A parasite is a biotic factor.

What is a parasite really?

Parasite: an organism that depends on the host organism for its survival. It gets all its nutrients, food and shelter from the host, and sometimes, it even harms the host organism. It includes organisms like fungi, protozoas etc.

Parasites can also cause diseases in humans, examples of parasites that cause diseases are protozoa, ectoparasites, helminthes, etc.

Other examples are tapeworms, fleas and barnacles. Tapeworms are attached inside the intestines of animals like pugs, cows, etc.

Parasites get inside our bodies by the following ways:

Poor hygiene Weak immune system Visiting areas that have parasites Bad sanitationHiv/ aids

Therefore, parasites are biotic factors. They depend on hosts for survival.

Learn more about parasites here:
https://brainly.com/question/999225
#SPJ1

A pair of chromosomes, one inherited from the mother, the other from the father. They occur in pairs, are similar size and shape, and carry the same gene sequences.

Answers

A homologous chromosome is one of two chromosomes that share the same gene sequence, , chromosomal lengths, and centromere position. Two chromosomes, one paternal and one maternal, homologous pair.

What does biology homologate?

possessing the same conventional arrangement and position. In biology, the term "homologous" can look at two anatomical features or behavioral characteristics that developed from a structure or characteristic of their shared ancestor organism.

Homologous structures: what are they?

Organs or skeletal components that are homologous in structure are those that indicate a relationship to a common ancestor due to their similarities. They can be found in mammals and other species. Both the appearance and the function of these structures don't have to be identical.

To know more about homologous visit:

https://brainly.com/question/13242901

#SPJ4

Parts of a mast cell and their functions

Answers

Our bodies include mast cells, a type of white blood cell. They discharge "mast cell granules," which are chemicals that can help fight off sickness and infection.

Components of mast cell

Histamine, heparin, a number of cytokines, chondroitin sulphate, and neutral proteases are among thee inflammatory mediators that are stored in the 50–200 massive granules that make up the cytoplasm of the mast cell.

Functions of mast cell

Mast cells help regulate other types of immune responses as well as how the immune system reacts to certain germs and parasites. They contain substances including growth factors, cytokines, heparin, and histamine.

Human mast cells come in two different phenotypes: connective tissue mast cells, which produce chymase, tryptase, and carboxypeptidases, and mucosal mast cells, which exclusively produce tryptase (6, 7). In different tissues and organs, mast cell activation and mediator release have varied effects.

To know more about cytoplasm, visit:

https://brainly.com/question/18540744

#SPJ1

what are some of the organs involved in the respiratory system​

Answers

Answer:

Respiratory system organs: Lungs, trachea, Nose

Explanation:

How is the Respiratory system helpful.

The Respiratory system helps your help take out carbon dioxide and take in oxygen.

What's the Respiratory System.

It's a system of organs and tissues that help you breathe.

Want to learn more visit this link.

https://brainly.ph/question/9557224

Plants gather the suns energy with light-absorbing molecules. What are these molecules called?.

Answers

Answer:

photosystems

Explanation:

The molecules that hold the pigments that capture light energy used in photosynthesis are called photosystems. There are actually two types of photosystems in the thylakoid membrane (PSI) (PSII).

Which of the following is NOT a method for living more sustainably on Earth?a) Repair products when it breaks or gets worn out. Many brand name companies including clothing and electronic stores offer repair services for you nowb) Reuse with refillable glass or stainless stell water bottles and by shopping with cloth bags at grocery and retail stores including malls.c) Refuse to use single-use products such as plastic grocery bags and takeout utensils including straws and condiments for ketchup and soy sauce.d) Recycle by using plastic shopping bags to dispose paper/plastics/bags/metals into blue bins and composting organic waste into green bins.e) Reduce by shopping only in-store (online shipping orders have escess packaging) and buying only essential costumer products (not the latest fashion in clothing or the newest model in electronics) or think about renting seasonal items rather than buying it.

Answers

Sustainability is about maintaining the ecosystem diverse and productive, even attending the needs of production for humanity as well.

In order to do so, it's important to be careful about the disposal of any types of trash. So, avoiding to dispose of trash unnecessarily is really important, therefore A is correct. It is also important to avoid creating unnecessary trash, what happens when we chose to consume only water from plastic bottles, for example, instead of using reusable bottles. This means that B is also correct. Talking about not creating unnecessary trash, C is also correct, because it talks about avoiding single-use products. Also, avoiding the creation of unnecessary trash is related to E, because it's about avoiding excess packaging and/or avoid buying unnecessary items, reusing the same ones instead. Therefore, alternative D is incorrect, because while it talks about recycling it also incites the usage of plastic bags to dispose trash, which could be replaced by paper bags, for example.

Other Questions
at the rate shown in the table how many books were sold in 3 weeks The table gives a set of outcomes and their probabilities. Let A be the event "the outcom less than or equal to 2". Let B be the event "the outcome is a divisor of 3". Find P(AB). Outcome Probability 1 0.2 2 0.6 3 0.2 Give directions to a person to get to your school from your home. What is the value of u? H 88 U +64 I K 88 50 J U = use the distributive property to solve 4 ( 10 + 7) An arithmetic sequence has the followingproperties:i) Its 6th term is 15.ii) Its 9th term is three times the 2nd term.Find the 100th term of this sequence. I went to the bank 4 times last week and withdrew a total of $160. What was theaverage amount withdrew each time? Write and solve an expression to find theanswer plants usually extract these elements from soil, and humans obtain them from plant foods or from animals that have eaten plants and they are inorganic elements essential to human metabolism. in nutrition these elements are called The table lists recommended amounts of food to order for 25 party guests. Amanda and Syndey are hosting a graduation party for 40 guests. They know there will also be guests stopping by who may have come from other parties. For ordering purposes, they will count each of these "drop-in" guests as half a guest. How much of each food item should Amanda and Syndey order for a graduation party with 45 drop-in guests? help me with this plss m/cour16121/quizzes/2919544/take22A totem pole casts a shadow 45 feet long at the same time that a 6-foot-tallmancasts a shadow that is 3 feet long. Find the height of the totem pole.Height of the totemfeetHint: set a proportion like this oneshadow totemshadow manactual height totem actual height manucation Find the principal P that corresponds to the future value F= $1,300 under r = 4% interest compounded daily for t = 3 years. Round your final answer to two decimal places. Simply this expression 4(1-3x)+7x-8 Sound is measured in decibels, using the formula d = 10 log() where P is the intensity of the sound and P, is the weakest sound the human ear can hear. A horn has a decibel warning of20. How many times more intense is this horn compared to the weakest sound heard to the human ear? If John Carlo has 4 times as many nickels as quarters and they have a combined value of 270 cents, how many of each coin does he have? Hi I need a fit of help with this question! Question 3 (1 point)Tin lives in Atlanta and observes the moon as a waxing gibbous. Her cousin lives halfway around the world in China. Do Tinand her cousin see the same phase of the moon at the same time? Every week Ben collects a few pounds of paper to recycle. The graph below shows the total number of pounds of paper(y) that Ben collected in a certain amount of time (x), in weeks: two trains leave town 906 miles aprt at the same time and travel each other. one train travels 21 mi/h faster than other. if they meet in 6 hours, what is the rate of each train? The Rainforest Pyramid at Moody Gardens is a rectangular pyramid that has glass sides to allow the sunlight to enter the building. The base of the building is approximately 320 feet wide and 200 feet long. The height of each side is approximately 140 feet. How many square feet of glass were needed to cover the lateral sides of the pyramid?