Determine if the conclusion follows logically from the premises.Premise: If you have a maple tree, then you have to rake leaves in autumnPremise: Jon has to rake leaves in autumnConclusion: Jon has a maple treeValid argumentInvalid argument

Answers

Answer 1

The conclusion is an invalid argument.

Because if you have any tree you have to rake leaves in autumn. THen Jon could possibly have any tree.

Thus the argument is invalid


Related Questions

What is the range 12 ,20,18,25,6

Answers

The maximum of data is 25

The minimum of data is 6

Then, the range is:

range = maximum - minimum

range = 25 - 6

range = 19

3x and 8x are like terms.true or false

Answers

Like terms are those terms whose variable and its corresponding exponent are the same. Here we have 3x and 8x. Both terms have the number:

[tex]x^1[/tex]

Which means that they have the same variable and the same exponents. Then they are like terms and the answer is True.

Moshde runs a hairstyling business from her house. She charges $42 for a haircut and style. Her monthly expenses are $1070. She wants to be able to put at least $1,249 per month into her savings account order to open her own salon. How many "cut & styles" must she do to save at least $1,249 per month?

Answers

ANSWER:

56 cut & styles

STEP-BY-STEP EXPLANATION:

They tell us that each haircut and style charges $42 and that the monthly expenses are $1070, he wants to save a total of $1249, with this information we can establish the following equation:

[tex]42x-1070=1249[/tex]

Where x would be the amount of cut & styles, we solve for x:

[tex]\begin{gathered} 42x=1249+1070 \\ x=\frac{2319}{42} \\ x=55.2 \\ x\cong56 \end{gathered}[/tex]

If you make a total of 55 cut & styles, the amount does not reach a total of $1249 per month, therefore, at least 56 cut & styles are needed, to achieve the monthly goal.

Write an expression for the operation described.

"5 divided by the product of 3 and 2"

A (5 ÷ 3) × 2(5 ÷ 3) × 2
B 3 × (2 ÷ 5)3 × (2 ÷ 5)
C (3 × 2) ÷ 5(3 × 2) ÷ 5
D 5 ÷ (3 × 2)

Answers

D]  5 ÷ (3 × 2) is the expression for the operation "5 divided by the product of 3 and 2".

The operation "5 divided by the product of 3 and 2" means that number 5 divided by the product of 3 and 2.

The mathematical representation of this operation is 5 ÷ (3 × 2).

The answer to this operation = 5 / 6.

Hence, 5 ÷ (3 × 2) is the expression for the operation "5 divided by the product of 3 and 2".

To understand more about multiplication and division refer -

https://brainly.com/question/28768606

#SPJ1

Type the correct answer in the box. Use numericals instead of words. 5 less than a number is equivalent to 1 more than three times the number. The number is _____.

Answers

Answer:

2

Explanation:

Let the number be x

5 less than a number is expressed as x - 5

1 more than three times the number is expressed as 3x + 1

Equate both expression and find the number

x - 5 = 3x+1

x - 3x = 1 - 5

-2x = -4

x = -4/-2

x = 2

Hence the number is 2

1/9=_/54What is the answer?

Answers

[tex]\begin{gathered} \frac{1}{9}=\frac{x}{54} \\ \frac{1}{9}\cdot54=\frac{x}{54}\cdot54 \\ \frac{54}{9}=x \\ \\ 6=x \\ \\ \\ \text{thus} \\ \frac{1}{9}=\frac{6}{54} \end{gathered}[/tex]

3. A toy box is 24 cm long, 15 cm wide and 11 cm high. What is the volume of the toy box? What is the correct number sentence for this problem? A.V=24×15×11B.V=24×15C.V=24×11D.V=15×11

Answers

ANSWER

[tex]\begin{gathered} V=24*15*11 \\ V=3960\text{ }cm^3 \end{gathered}[/tex]

EXPLANATION

The box is a rectangular prism. The volume of a rectangular prism is given by:

[tex]V=L*W*H[/tex]

where L = length

W = width

H = height

Therefore, the volume of the box can be written in the number sentence:

[tex]V=24*15*11[/tex]

and the volume of the box is:

[tex]V=3960\text{ }cm^3[/tex]

That is the answer.

Amelia bought spider rings for Halloween goodie bags. She bought 13 packs of red rings, 16 packs of yellow rings, and 14 packs of green rings. If each pack had 12 rings, how many rings did Amelia buy?

Answers

We know that

• She bought 13 packs of red rings.

,

• She bought 16 packs of yellow rings.

,

• She bought 14 packs of green rings.

,

• Each pack has 12 rings.

This problem is about multiplication, notice that each pack includes 12 rings, that means we need to multiply each pack by 12, in order to find the total number of rings of each color.

[tex]R=13\cdot12=156[/tex]

There are 156 red rings.

[tex]Y=16\cdot12=192[/tex]

There are 192 yellow rings.

[tex]G=14\cdot12=168[/tex]

There are 168 green rings.

Now, we sum all these numbers to find the total

[tex]T=168+192+156=516[/tex]Therefore, there are 516 rings in total.

Can someone please help me find the value of X?

Answers

Remember that

the sum of the interior angles in any polygon is equal to

S=180(n-2)

where

n is the number of sides of polygon

In this problem

we have

n=6 (hexagon)

so

substitute

S=180(6-2)

S=720 degrees

step 2

Adds the interior angles

720=120+(5x-6)+(4x+14)+(7x)+(8x-8)+(6x)

solve for x

combine like terms

720=30x+120

30x=720-120

30x=600

x=20

How many pounds of candy that sells for $0.85 per Ib must be mixed with candy that sells for $1.22 per lb to obtain 9 lb of a mixture that should sell for $0.92 per lb? 50.85-per-lb candy: 73 lb (Type an integer or decimal rounded to two decimal places as needed.) $1.22-per-b candy

Answers

This system gives two equations

[tex]\frac{0.85x+1.22y}{9}=0.92[/tex][tex]x+y=9[/tex]

where x is the number pounds of $0.85/lb candy and y is the number of pounds of $1.22/lb candy.

The solution to the system is

[tex]x=7.297[/tex][tex]y=1.70[/tex]

Hence, 7.297 lb of $0.85 candy is required in order that if we mix them with 1.70 lb of $1.22 candy, we will get a 9 lb solution of 0.92 /lb candy.

1. What is the other endpoint of the segment with midpoint -3 and endpoint -7? A-11 01 D 4 B -5 2. The endngints of ST are S(2,-2) and T14, 2). What are the coordinates of the

Answers

We have a segment with points S and T.

We know the coordinates of S=(2,-2) and the midpoint M=(-

An online company is advertising a mixer on sale for 35% off the original price of $224.99 what is the sale price for the mixer? Round your answer to the nearest cent, if necessary.

Answers

Given:

The original price of mixer is $224.99.

The discount on the mixer is 35%.

Explanation:

Determine the discount amount on the mixer.

[tex]\begin{gathered} d=\frac{35}{100}\cdot224.99 \\ =78.7465 \end{gathered}[/tex]

Determine the sale price of the mixer.

[tex]\begin{gathered} 224.99-78.7465=146.2435 \\ \approx146.24 \end{gathered}[/tex]

So sale price of the mixer is $146.24.

Vanessa collected Barbie dolls. She began with 2 dolls and added the same amount of dolls to her collection each year. In the 24th year, Vanessa had 98 dolls. Which function, d(n), can be used to determine the number of dolls Vanessa had in any year?

Answers

The correct answer is d(n) = 4n +2

Could you help me with how to multiply polynomials(5x - 1)(2x^2 -3x + 4)

Answers

ANSWER:

[tex](5x\: -\: 1)(2x^2\: -3x\: +\: 4)=10x^3-17x^2+23x-4[/tex]

STEP-BY-STEP EXPLANATION:

We have the following multiplication of polynomials:

[tex]\mleft(5x-1\mright)\mleft(2x^2-3x+4\mright)[/tex]

When multiplying two polynomials we must bear in mind that all the terms of the first polynomial must be multiplied by all the terms of the second polynomial, like this:

[tex]\begin{gathered} \mleft(5x-1\mright)\mleft(2x^2-3x+4\mright)=5x\cdot2x^2+5x\cdot-3x+5x\cdot4+(-1)\cdot2x^2+(-1)\cdot-3x+(-1)\cdot4 \\ (5x\: -\: 1)(2x^2\: -3x\: +\: 4)=10x^3-15x^2+20x-2x^2+3x-4 \\ (5x\: -\: 1)(2x^2\: -3x\: +\: 4)=10x^3-17x^2+23x-4 \end{gathered}[/tex]

the sum of 6 times a number and 8 equals 7? translate into equation

Answers

Let:

x = Unknown number

the sum of 6 times a number:

[tex]6x+[/tex]

and 8 equals 7, so:

[tex]\begin{gathered} 6x+8=7 \\ \text{solve for x:} \\ \text{subtract 8 from both sides:} \\ 6x=7-8 \\ 6x=-1 \\ \text{divide both sides by 6:} \\ x=-\frac{1}{6} \end{gathered}[/tex]

Differentiate a trig function that is greater than a power of 1, and involve either quotient, chain, or product rule.Differentiate a sine and cosine function that involves product and chain rule. Find the equation of the tangent line at x = a special triangle point (i.e. /4, /6, /3).Differentiate a function that involves both trig and exponential functions.[hint: add your own twist to this question for level 3/4]Differentiate an exponential function. [hint: add your own twist to this question for level 3/4]Differentiate a function where you have “y” and “x” on both sides of the equation and they cannot be simplified by collecting like terms or isolating y (i.e. y on one side and y^2 on the other). [hint: add your own twist to this question for level 3/4]

Answers

Solution:

Given a trigonometric function that is greater than power of 1 as shown below:

[tex]y=sin^2x\text{ ---- equation 1}[/tex]

To differentiate the function, we use the chain rule.

According to the chain rule,

[tex]\frac{dy}{dx}=\frac{dy}{du}\times\frac{du}{dx}[/tex]

From equation 1, let

[tex]u=sin\text{ x --- equation 2}[/tex]

This implies that

[tex]\begin{gathered} y=u^2 \\ \Rightarrow\frac{dy}{du}=2u \end{gathered}[/tex]

From equation 2,

[tex]\begin{gathered} \begin{equation*} u=sin\text{ x} \end{equation*} \\ \Rightarrow\frac{du}{dx}=cos\text{ x} \end{gathered}[/tex]

[tex]\begin{gathered} Recall\text{ from the chain rule:} \\ \frac{dy}{dx}=\frac{dy}{du}\times\frac{du}{dx} \\ \Rightarrow2u\times\text{cos x} \\ \frac{dy}{dx}=2ucos\text{ x} \\ but\text{ } \\ u=sin\text{ x} \\ \therefore\frac{dy}{dx}=2(sin\text{ }x)(cos\text{ }x) \end{gathered}[/tex]

determine whether the binomial expression is a factor to the following polynomial.[tex]p(x) = {x}^{3} - 9x + 1 \: \: \: \: \: \: \: \: \: (x - 3)[/tex]the binomial expression is (x-3) ^^answer choicesA. yesB. no

Answers

We can find if (x-3) is a factor by dividing P(x) by (x-3).

A simpler way is replacing x with 3 and if the value of P(x) is 0, then (x-3) is a factor of P(x). This is because x=3 is a root of P(x) and therefore it can be factorized with the term (x-3).

Then, we calculate P(3):

[tex]P(3)=3^2-9\cdot3+1=9-27+1=-17[/tex]

As x=3 is not a root of P(x), then (x-3) is not a factor of P(x).

Answer: No.

in the diagram, ab to ec are perpendicular. if m

Answers

[tex]\begin{gathered} \text{sorry,} \\ 9x+13x+2=90 \\ 22x+2=90 \\ 22x=90-2 \\ 22x=88 \\ x=\frac{88}{22} \\ x=4 \end{gathered}[/tex][tex]\text{angle MEB=9x, since x=4, hnce, angle MEB=36}[/tex]

The table below shows the cost of downloading songs from a website.Number of Songs Total Cost11$10.5613$12.4818.$17.28At this rate, what is the cost per song?Answer: $per song

Answers

To know the cost per song we make a division between the total Cost and the number of songs, then we can take any pair of data

I will use 11 songs and $10.56

[tex]\frac{10.56}{11}=\frac{24}{25}=0.96[/tex]

to check we can use another pair (18 songs and $17.28)

[tex]\frac{17.28}{11}=\frac{24}{25}=0.96[/tex]

then the cost per song is $0.96

Find the height of the cliff. If necessary, round to the nearest hundredth yard.

Answers

We are given a diagram showing a slope, and a vertical height. We now have what represents a right angled triangle. The distance from the base of the cliff to the end of the slope is given as 24 yards. The slope itself is 37 yards. We shall now determine the height of the cliff (from ground to top) as indicated.

Note that we shall use the Pythagoras' theorem which is;

[tex]c^2=a^2+b^2[/tex]

Where we have

[tex]\begin{gathered} c=\text{hypotenuse (longest side)} \\ a,b=\text{other sides} \end{gathered}[/tex]

We can now substitute the given values/side lengths and we'll have;

[tex]37^2=24^2+b^2[/tex][tex]1369=576+b^2[/tex]

Subtract 576 from both sides;

[tex]793=b^2[/tex]

Take the square root of both sides;

[tex]\begin{gathered} \sqrt[]{793}=\sqrt[]{b^2} \\ 28.160255\ldots=b \end{gathered}[/tex]

Rounded to the nearest hundredth, the answer now becomes;

ANSWER:

[tex]b=28.16yd[/tex]

The last option is the correct answer

which value must be added to the expression x^2 + x to make it a perfect-square trinomial

Answers

A perfect square trinomial is written in the form

[tex]undefined[/tex]

Translate to a system Reiko needs to mail her Christmas cards and packages and wants to keep her mailing costs to no more than $500. The number of cards is at least 4 more than twice the number of packages. The cost of mailing a card (with pictures enclosed) is $3 and for a package the cost is $7.

Answers

Given:

Let x be the number of the cards and y be the number of the package.

Given that the number of cards is at least 4 more than twice the number of packages.

[tex]x=2y+4[/tex]

Given that mailing costs no more than $500 and the cost of mailing a card is $3 and for a package, the cost is $7.

[tex]3x+7y=500[/tex]

Substitute x=2y+4 in this equation, we get

[tex]3(2y+4)+7y=500[/tex]

[tex]6y+8+7y=500[/tex]

[tex]13y=500-8[/tex]

[tex]y=\frac{492}{13}[/tex][tex]y=37.8[/tex]

Let y=37 and substitute in x=2y+4, we get

[tex]x=2\times37+4[/tex][tex]x=78[/tex]

Hence the number of cards = 78 and the number of packages =37.

The total cost for this is $493 not more than $500.

5.Line AB is 14 inches long. What is the approximate area of this circle?АBa. 42 square inchesb. 615 square inchesc. 160 square inchesd. 154 square inches

Answers

The area of a circle is given as

A =

Is there any other further step I need to do? The answer is very close but not exact so I’m unsure.

Answers

Given the matrices:

[tex]A=\begin{bmatrix}{10} & {4} & {0} \\ {1} & {3} & {1}\end{bmatrix},B=\begin{bmatrix}{4} & {1} & \\ {2} & {2} & {} \\ {0} & {-1} & \end{bmatrix}[/tex]

we will find the value of AB + I

First, we will find the product of AB as follows:

[tex]AB=\begin{bmatrix}{10} & {4} & {0} \\ {1} & {3} & {1}\end{bmatrix}\cdot\begin{bmatrix}{4} & {1} & \\ {2} & {2} & {} \\ {0} & {-1} & \end{bmatrix}=\begin{bmatrix}{10\cdot4+2\cdot4+0\cdot0} & {1\cdot01+4\cdot2+0\cdot-1} & {} \\ {1\cdot4+3\cdot2+1\cdot0} & {1\cdot1+3\cdot2+1\cdot-1} & {} \\ {} & {} & {}\end{bmatrix}[/tex]

simplifying the answer:

[tex]AB=\begin{bmatrix}{48} & {18} & {} \\ {10} & {6} & {} \\ {} & {} & {}\end{bmatrix}[/tex]

Now, we will add the unity matrix to the answer:

[tex]AB+I=\begin{bmatrix}{48} & {18} & {} \\ {10} & {6} & {} \\ {} & {} & {}\end{bmatrix}+\begin{bmatrix}{1} & {0} & {} \\ {0} & {1} & {} \\ {} & {} & {}\end{bmatrix}=\begin{bmatrix}{49} & {18} & {} \\ {10} & {7} & {} \\ {} & {} & {}\end{bmatrix}[/tex]

So, the answer will be option D

Which point shows the number with the greatest absolute value? А B + + D TH 30 40 50 -50 -40 -30 - 20 -10 0 10 20 O Point A O Point B O Point C O Point D ہ

Answers

We are shown points A, B, C, and D on a number line.

We are asked to find out which point shows the number with the greatest absolute value?

Recall that the absolute value of a number is always positive.

The negative values of points A and B will become positive.

As you can see from the number line, point A is closer to -40 and the point D is closer to 30

The absolute value of point A will be closer to |-40| = 40

Since 40 is greater than 30, point A shows the number with the greatest absolute value.

Therefore, the correct answer is Point A.

Prison Sentences The average prison sentence for a person convicted of second-degree murder is 15 years. If the sentences are normally distributed with astandard deviation of 2.1 years, find the following probabilities.P (x> 18) =

Answers

Givens.

• The mean is 15 years.

,

• The standard deviation is 2.1 years.

,

• x = 18.

Using a graphic calculator, the probability P(X > 18) is 0.0766.

Therefore, the answer is 0.07

h(x) =x² +9 if h(x)=9 , x =

Answers

The given expression as; h(x) =x² +9

for h(x) = 9

Substitute the value of h(x) = 9 in the given expression;

h(x) =x² +9

9 =x² +9

x² = 9 - 9

x² = 0

x = 0

Answer : x = 0

Thomas is married and files jointly with his spouse. Their combined taxable income is $25,799. Their employers withheld $4,386 in taxesfor the year. Determine theamount to be refundedor the balance due.Circle one: RefundBalance Due

Answers

EXPLANATION

As we can see on the table, the amount to be refunded is equivalent to the difference between $3,866 and $4,386, so it is $520

Callie's grandmother pledged R150, 00 for every mile Callie walked in her walk-a-thon. Callie walked 14.5 km. How much does her grandmother owe? ( assume 8 km = 5miles)

Answers

Given:-

Callie walked 14.5 km. And also given 8 km=5 miles.

At first we convert 14.5 km to miles. we get,

[tex]\begin{gathered} 14.5\times\frac{5}{8}=\frac{72.5}{8} \\ \text{ =9.0625} \end{gathered}[/tex]

So 14.5 km is 9.0625 miles.

Callie's grandmother pledged Rs. 150 for every mile. so for 9.0625 miles it is,

[tex]9.0625\times150=1359.375[/tex]

So her grandmother owe Rs. 1359.375

Hi, what is the LCM of the numbers 3 and 15

Answers

Answer:

15

Step-by-step Explanation:

LCM is the least common multiple, that is, is the least number that is a multiple of both numbers.

To find it, first, let's write the multiples of 3:

Multiples of 3: 3, 6, 9, 12, 15, 18, 21, 24, 27, 30, ...

Now, let's write the multiples of 15:

Multiples of 15: 15, 30, 45, ...

If you compare the multiples of 3 and 5, we can see that they have some common multiples, as 15 and 30.

From this common multiples, 15 is the smallest number. So, 15 is the LCM of 3 and 15.

Answer: 15.

Other Questions
The Fishers ate out at a restaurant and paid a total of $68.22, including the tip. If the Fishers tipped 20%, what was the cost of the meal? What effect does propaganda have on people? Is it more of a negative or positive effect? Explain within 5-7 sentences and provide at least ONE example. Wich expression is equivalent to a+(c+7) Which of the following things is not contained at the plane B? find the value of x then find the measure of both angles What question I can ask about plays DRAMATIC CHARACTERS? what question I can ask about MUSICAL THEATRE?I also need a brief description for both questions and also a source. 1-58. Copy the number line below and place the following probabilities on it In materials such as metals, the outer shell electrons are loosely bound to the nuclei of their atoms and are free to move from one atom to another. These materials are good conductors. Is this true or false? 25. Ally is making a replica of a building that is at ascale of 4 m. to 3 in.The model is 84 in tall. How tallis the building? For a 4s orbital ,what are the possible values of n, l and ml. SC61.14.214. The hierarchy of the body is shown belowWhich of the following statements is NOT part of the cell theoryA Cells are made of molecules,Bells make up all organismsC.Cells are the basic unit of lifeD. Cells come from pre-existing cell Devin owes $26,000 in students loans for college. The interest rate is 8.75% and the loan will be paid off over 15 years. How much will Devin pay altogether?$60,125$72,123$3,412,500$8,125 MAH ~ WCF what is the value of x?picture will be sent in messages where can I find L1 and L4 ? for missing alternate angles 4p-9=2p+21solve the equation write an inequality for the graph using x for the variable. Evaluate the determinant.7 3 28 2 76 8 5A) 212B) -464 -212D860 How did the French respond when the United States refused to pay debts owed to France. Question 4Below is the CODING STRAND of a small gene that codes for a peptide. Assume the gene has atraditional start codon.How many amino acids long is the peptide if we assume traditional start and traditional stopcodon?5' AATCCGTATCTATGACCGTTTGGAAACACTAAGCGGTACTC 3'3569 Which equations represent a linear function? Select two. a. y = x-1 b. y = 4.5 C. 3x 4y = 2 d. 5x2 = 10y e. y = 1/2x2 +6