You have made a smear of a bacterial culture and have performed the Gram stain on it. Looking at the organism under the microscope, you notice that the cells do not seem to be the dark blue-purple of a gram-positive reaction, but instead are light blue. Your staining procedure was performed correctly. What is your best explanation as to why the bacteria have stained this way?A.forgetting to heat fix the smear B.skipping the iodine step C.skipping alcohol steps D.skipping the Safranin step E. skipping the crystal violet step

Answers

Answer 1

If we have to think quickly about the function of each component we would say that:

-fixing the semar is for adhesion to slide glass

-lugol will fix the violet crystal dye to bacteria

-alcohol eliminate the violet crystal from gram negative ones

-safranin, will stain the gram negatives which are the ones that are discolored

So if your preparation is clearer than usual I would think in:

Option B skipping the iodine step therefore there would be no intensification in crystal violet (this could be the best explanation).

Option A forgetting to heat fix the smear, this is a previous and fundamental step that makes adhesion to slide glass. If you skip it, probably your preparation could be clearer than usual since the bacteria did not fix correctly to the glass.


Related Questions

How many times more energy is produced by all three stages of cellular respiration than by glycolysis alone

Answers

The all three process of cellular respiration produces 18 times more ATP than glycolysis alone.

As there are 4 ATP produced in glycolysis from one molecule of glucose,2 from Krebs cycle, and rest 34 from electron transport chain.

These three process made total of 38 ATP

Cystic fibrosis is caused by an autosomal recessive allele (n). The allele for the normal condition is dominant (N). Two parents appear normal, but the mate has a brother withcystic fibrosis. Which of the following tools will BEST help this family predid their chances of carrying and passing this disease to their offspring?a test Crossa pedigreeO hydrolysisOPunnet SquareBackNexdAll PreviousType here to searchti

Answers

The Punnett square is a square diagram that is used to predict the genotypes of a particular cross or breeding experiment. It is named after Reginald C. Punnett, who devised the approach in 1905. The diagram is used by biologists to determine the probability of an offspring having a particular genotype.

Answer: Punnet Square

Is the trait (blue) in the pedigree most likely caused by the presence of a dominant or recessive allele?Group of answer choicesrecessivedominantneitherboth

Answers

The blue trait is most likely caused by a dominant allele (e.g. allele A), while the white trait is caused by a recessive allele (allele a). However, for the diagram to be correct, individuals 1I and 2I must have genotypes Aa (blue) and aa (white) respectively, thus making the punnet squares, the genotypes of their offspring would be Aa (blue) and aa (white). In turn, we can verify that this is correct by observing the third generation since if the blue individuals of the second generation had genotype AA, they could not have white offspring (aa). If we make all the crosses, the genotypes would be as follows:

1 I: Aa 2 I: aa

1 II: Aa 2 II: aa 3 II: aa 4 II: aa 5 II: Aa 6 II: aa 7 II: Aa 8 II: Aa

1 III: Aa 2 III: aa 3 III: aa 4 III: aa 5 III: aa 6 III: Aa or AA 7 III: aa 8 III: Aa or AA 9 III: aa

The restriction enzyme EcoR1 recognizes the DNA sequence GAATTC. Which DNA strands will be cut by
EcoR1?
i. TTCAGGAATTCGGAAACC
AAGTCCTTAAGCCTTTGG
ii. TGAATCGAACCTG
ACTTAGCTTGGAC
iii. TTAAGCGGCCGAATTCAGTCCA
AATTCGCCCGCTTAAGTCAGGT
iv. CAGTAGGATTTCTGTGTC
GTCATCCTAAAGACACAG

Answers

EcoR1 creates 4 nucleotide sticky ends with 5' end overhangs of AATT.

These are the two options (i) and (iii) and the red marks indicate how the segment would be cut. So, the correct answer is option (iii)

Please give me brainliest

lWhich of the following are renewable resources?I. WindII. SolarIII. TidalIV. BiomassA. I, II, III, IVB. I, II, and IIIC. II and IIID. I, II, and IV

Answers

The renewable resources, that do not run out, but are continually renewed by nature, are:

I. Wind

II. Solar

III. Tidal

But not biomass.

When a population is growing as fast as possible, it has reached its ___________.A. Carrying CapacityB. Competitive ExclusionC. Allele FrequencyD. Biotic Potential

Answers

General category: Biology.

Sub-category: Ecology

Topic: Population growth

Introduction:

The Biotic potential is described by the unrestricted growth of populations. This event causes the maximum growth of that population.

Explanation:

By definition, when a population reaches the biotic potential, then the species has its highest birthrate or a high number of births or accelerated population growth and lowest mortality rate.

we can conclude that the correct answer is:

Answer:

D. Biotic Potential

These are the steps that occur during transcription. They are not in the correct order. Write numbers in the blanks indicating the order in which these steps occur.

RNA polymerase reaches the termination signal.

The enzyme, RNA polymerase, binds to a site on the DNA molecule called the promoter.

Complimentary RNA nucleotides are added along the DNA template strand.

The RNA strand is released and travels to the cytoplasm.

RNA polymerase separates the DNA strands.

Answers

Explanation:

Step 1: Initiation

Initiation is the beginning of transcription. It occurs when the enzyme RNA polymerase binds to a region of a gene called the promoter. This signals the DNA to unwind so the enzyme can ‘‘read’’ the bases in one of the DNA strands. The enzyme is now ready to make a strand of mRNA with a complementary sequence of bases.

Step 2: Elongation

Elongation is the addition of nucleotides to the mRNA strand. RNA polymerase reads the unwound DNA strand and builds the mRNA molecule, using complementary base pairs. During this process, an adenine (A) in the DNA binds to an uracil (U) in the RNA.

Step 3: Termination

Termination is the ending of transcription, and occurs when RNA polymerase crosses a stop (termination) sequence in the gene. The mRNA strand is complete, and it detaches from DNA.

Why do we use onion root tips and whitefish embryos to view mitosis?

Answers

Cells divide for three reasosn: growth, reproduction and repair.

Onion root tips and whitefish embryos presents cells that's always undergoing mitosis.

Onion root tips are always growing to get more water and nutrients from the soil, therefore mitosis is always occuring to duplicate the cells and maintain a growing rate.

Whitefish embryos have cells that are undergoing mitosis rapidly, as it is a phase of intense growing and formation of the embryos to become fish.

Which of the following is NOT a consequence of using fossil fuels?A. Copper sulfate is released, contributing to destruction of the Ozone layer.B. Carbon dioxide is released, contributing to global warming.C. Sulfur dioxide is released, contribing to acid rain.D. Ash is released, contributing to solid waste in landfills.

Answers

Biology > Ecology > Air pollution

Burning fossil fuels such as gasoline or oil generates numerous pollutants, such as ashes, sulfur and carbon dioxides, which contaminate the environment, affect air quality and contribute to global warming.

One of the compounds not generated during this process is copper sulfates. Therefore, the answer is A.

The digestive process involves two main types of digestion. Identify each one and explain how each works to break down food. Indicate where each type of digestion takes place in the body.

please help need to finish on Friday

Answers

The two types of digestion include the following below:

Mechanical digestion - This involves the use of physical methods and force to break down food such as in the mouth.Chemical digestion  - This involves enzymatic action to break food down such as in the stomach.

What is Digestion?

This is referred to as the process in which food is broken down into smaller substances so as to be acted on by enzymes and assimilated into the bloodstream for the optimal functioning of the body.

Mechanical digestion happens in the mouth and it involves processes such as chewing while chemical digestion involves the breakdown of food through enzymatic actions.

Read more about Digestion here https://brainly.com/question/21470803

#SPJ1

Explain why giraffes have long necks.In your explanation include the role of the environment, selective pressure, 3 ingredients to Natural Selection, The effect on the population, and allele frequency

Answers

Giraffes are believed to have short necks but there was a chance in neck length variations. Some giraffes have a little longer compared to the average length. The main source of nutrition for giraffes is tree leaves. Maybe there was an environmental change that occurred that there was a limited source of leaves and as a result, there were more giraffes than trees; therefore, there is a struggle for existence.

In this event, variation, fitness differences, and inheritance (3 ingredients of natural selection) must occur for the species to survive. Longer necked giraffes are more likely to reach the leaves of the trees and have a higher chance of survival and reproduction; thus, they have greater fitness. This trait (long necks) was passed on to the offspring and eventually, all giraffes have long necks.

The allele frequency of the population of giraffes eventually changes to favor the trait that will give the species a higher chance of survival in their environment.

What kingdoms of life can have either sexual or asexual reproduction?Plantae, archaea, fungiAnimalia, plantae, and fungiPlantae, protista, and fungiEubacteria, protista, and fungi

Answers

We have to consider that sexual and asexual reproduction differs in that the first one requires both organisms, one male and one female, to produce genetically different offspring, while the second one requires only one organism to produce genetically identical offspring.

About the kind of organisms mentioned in the answer options, we can say Protista includes Fungi, so the answer options that include both of them can be excluded, mainly due to choosing one of those options would exclude other organisms that can be in fact sexual or asexual.

Having this clear, we can say that organisms such as those belonging to the Plantae, Fungi, and Animalia kingdoms can reproduce in these two ways (unlike Archaea, and Eubacteria).

In the pictures below we can see examples of organisms of these species that can reproduce both asexually and sexually. In them, we can see ants (which can produce eggs with only the genetic load of one parental organism), plants (which can reproduce through branches, but also through seeds), and fungi (which can reproduce also mitotically and meiotically), as in the second answer option.

I need the answer to this question A.Or B.OrC.Or D

Answers

The endosymbiotic theory states that some organelles in eukaryotic cells are original from prokaryotic microbes (bacteria), being mitochondria and chloroplast the example of the theory. Therefore, for the students demonstrate the endosymbiotic theory with the biological material that was offered to them they have to show the big bacteria ingesting the small one.

What is the meaning of the term plankton? Name two types of plankton

Answers

EXPLANATION/ANSWER:

The term "plankton" comes from the Greek word "planktos" which means wandering. Planktons are microscopic organisms that are floating and being carried by tides and currents. There are two types of planktons: phytoplankton and zooplankton. Phytoplanktons are aquatic microorganisms that have chlorophyll and can make food from sunlight. Zooplanktons are aquatic microorganisms that consume phytoplanktons or other zooplanktons.

Name some structures that come from the brain region of the telencephalon

Answers

The telencephalon is formed by four major structures: cerebral cortex (the hemispheres parts of the brain), limbic forebrain (brain part where you can find amigdala), basal ganglia, and the olfactory system. There are also the subcortical structures that includes the hippocampus (part og hippocampal formation in the brain), and amygdala (brain center to regulate memory and others associated functions). The telencephalon is the farthest end of the neural tube, being during the developtment of the organism divided into two structures that will form the cerebral hemispheres. The cerebral cortex is also divided into prefrontal cortex, motor cortex, occipital cortex, and so on.

_________ are groups of organisms with the same genetic code that breed and produce offspring that can breed. AdaptationSpeciesSelectionCommunity

Answers

The correct option is species. Species are individuals linked by their reproductive characteristics and often by their evolutionary mechanisms and history.

Is my response to this good is there anything I can change or add to make it better? You now know what an ecosystem is—and how varied ecosystems can be. Pick an ecosystem near you—find one that it as large or small as you wish. All areas—urban, suburban, and rural—have many ecosystems to choose from. Write a description of the ecosystem, including biotic and abiotic factors, in NO MORE THAN FOUR SENTENCES.An ecosystem close to me is a river. Abiotic factors: High water quality and the water is very clear. The average water temperature is 55F, and the water gets a lot of sunlight. Biotic factors: There are many different types of fish, such as bull trout and salmon. Many different kinds of frogs live in and along the edges of the river, and various kinds of plants and algae.

Answers

River ecosystem is also referred to as lotic ecosystem. Important descriptions of a river ecosystem includes the temperature, flow of water, floods, sediment transport, river bed features, and structure of habitat. It can also include the geographical area. Biotic factors can include the other plants and animals around the river including the land and aerial animals. Abiotic factors can also include substrate and composition aside from the temperature and light factors you already mentioned.

In what situation would the allelefrequency of a population NOT change?A. when individuals move into or out of an environmentB. when there is no evolutionC. when mutations create new allelesD. when individuals choose their mates

Answers

Answer

B. when there is no evolution

Explanation

Ultraviolet light can be used to kill bacteria in food.TRUEFALSE

Answers

The correct answer is TRUE,

A ultraviolet light can kill bacteria in food the answer is true

Though DNA is responsible for the instructions for the assembly process, it is __?__ that synthesizes (assembles) the process.

Answers

Though DNA is responsible for the instructions for the assembly process, it is RNA that synthesizes (assemles) the proteins.

The researcher collects and crosses male and female flies from the F1 generation. In the resulting offspring (F2 generation), there are both stubble and ebony flies.How do I Draw a Punnett square to illustrate the F1 cross for the stubbly phenotype showing the individual gametes of each parent, and the combination in the resulting offspring.

Answers

Recessive allele: Ebony and stubble bristles.

We take it as

ssee- the small letter will show that it is recessive.

An organism is born with a genetic abnormality not present in any of its ancestors. This abnormality is most likely the result of?

Answers

Genetic diseases or abnormalities can be inherited or a result of a mutation, which is a change in the nucleotide sequence in the DNA of the organism.

Mutations can happen as a result of errors during mitosis or meiosis, as well as by damage from exposure to UV radiation or a chemical substance.

So, the right answer is mutation (option A)

In this process humans would select animals or plants with a trait they desire then breed those organisms to produce more individuals with the desired traits.Natural selectionContaminationInseminationArtificial selection.

Answers

The correct answer is Artificial selection.

Humans interfere in the natural process of organisms that they slect the desirable trait for the organisms that they think best will help the organisms to adapt well into their environment.

has warm temperatures and is dominated by grasses

Answers

Answer:

Grasslands (?)

Explanation:

You didn't give much context, but grasslands have warm temperatures and are generally dominated by grass--

Tropical grasslands have dry and wet seasons that remain warm all the time.

Temperate grasslands have cold winters and warm summers with some rain.

The most likely answer is tropical grasslands because they are warm all the time. (grasslands is a more open answer)

May I get help with number two and with a punnets square

Answers

The hemophilia gene is an X-linked recessive gene. This means that a person will be hemophiliac if has two copies of the recessive "h" allele (in the case of females) or if has one copy (in the case of males). This also means that if the individual possesses the dominant H allele, he or she will not have hemophilia. Therefore, when performing the punnet table of section 2, we can observe that only one of four descendants would present hemophilia and in this case, it would be a male with genotype X^h Y (25% male), and only one of four would be a carrier that doesn't present hemophilia and in this case, it would be a woman with genotype X^H X^h (25% female)

what is a co factor ?give examples

Answers

Answer:

Cofactors are inorganic or small organic molecules that bind enzymes to enable or enhance their activity. Common inorganic cofactors are metals, including but not limited to magnesium, manganese, zinc, molybdenum, cobalt, and copper.

Explanation:

If a couple has a 50% chance of producing an XX chromosome offspring withred-green colour deficiency, what is the genotype of the couple? For thecouple in Q5 (above) what is the percentage chance that their offspring willbe XY with normal colour vision? *note* Please enter numbers only - up to amaximum of 3 digits (0-100)

Answers

If the parents have XXrgrg and XYrg genotype, they have a 50% chance of producing an individual XX with red-colour deficiency.

Therefore, their offspring has 0% chance of being XY with normal colour vision.

How does dehydrating or drying food help preserve it?A. It decreases the smell so other animals won't come steal itB. Removing the water hinders the ability for chemical reactions, which keeps microbes from growingC. The food becomes smaller and more easily stored.D. This increases the good bacteria to hinder the growth of bad bacteria

Answers

Water is needed for all life forms, including microorganisms, removing the water from food to preserve it means the microorganisms cannot perform the chemical reactions needed to consume the food, so the food is preserved for a longer time (option B is the right answer).

A scientist is studying the inheritance of two characteristics in plants: red flowers (RR and Rr) , which are dominant to yellow flowers (rr) , and green leaves (GG and Gg) , which are dominant to yellow leaves (gg).She crosses a double heterozygous (RrGg) with a double recessive (rrgg), and expect to see a 1:1:1:1 ratio in the offspring.Instead, she sees these results: Which phenomenon would she hypothesize accounts for the pattern she sees?crossing-overindependent assortmentcytokinesisrespiration

Answers

It wouldn't be respiration, because it has no direct relation to procreation. It wouldn't be independent assortment also, because this is the phenomenon that would explain the expected result. It also wouldn't be cytokinesis because this phenomenon is related to cell division, in which the combinations are already set. So, it is crossing-over, because this phenomenon occurs when ther is a switch between homologous chromatids occured during meiosis, which means that the chromosomes are so close to each other that they can trade parts of itselfs with other chromosomes, unexpectedly providing a different outcome than the one that was expected. So, the answer is crossing-over.

Which of the following choices is a form of asexual reproduction?OOOOfragmentation and regenerationoviparous eggsovoviviparous developmentviviparous development

Answers

Fragmentation and regeneration are forms of asexual reproduction.

There are no sexual cells involved, and they divide by mitosis, giving genetically identical individuals.

Other Questions
A fire is an example of ________________ reaction, because heat is _____________ the system. A. exothermic; leaving B. exothermic; entering C. endothermic; leaving D. endothermic; entering 107. Cranky mower To start her old lawn mower, Rita hasS to pull a cord and hope for some luck. On any partic-ular pull, the mower has a 20% chance of starting.(a)Find the probability that it takes her exactly 3 pulls tostart the mower.(b) Find the probability that it takes her more than 6pulls to start the mower.108. 1-in-6 wins Alan decides to use a different strategy forthe 1-in-6 wins game of Exercise 90. He keeps buyingone 20-ounce bottle of the soda at a time until he getsa winner.Find the probability that he buys exactly 5 bottles.(b) Find the probability that he buys at most 6 bottles.Showyour work. A small pool can hold 72.5 gallons of water . The pool is currently 3/4full how many gallons are in the pool ? Find the missing angle:FRT=________ The Fishers ate out at a restaurant and paid a total of $68.22, including the tip. If the Fishers tipped 20%, what was the cost of the meal? What effect does propaganda have on people? Is it more of a negative or positive effect? Explain within 5-7 sentences and provide at least ONE example. Wich expression is equivalent to a+(c+7) Which of the following things is not contained at the plane B? find the value of x then find the measure of both angles What question I can ask about plays DRAMATIC CHARACTERS? what question I can ask about MUSICAL THEATRE?I also need a brief description for both questions and also a source. 1-58. Copy the number line below and place the following probabilities on it In materials such as metals, the outer shell electrons are loosely bound to the nuclei of their atoms and are free to move from one atom to another. These materials are good conductors. Is this true or false? 25. Ally is making a replica of a building that is at ascale of 4 m. to 3 in.The model is 84 in tall. How tallis the building? For a 4s orbital ,what are the possible values of n, l and ml. SC61.14.214. The hierarchy of the body is shown belowWhich of the following statements is NOT part of the cell theoryA Cells are made of molecules,Bells make up all organismsC.Cells are the basic unit of lifeD. Cells come from pre-existing cell Devin owes $26,000 in students loans for college. The interest rate is 8.75% and the loan will be paid off over 15 years. How much will Devin pay altogether?$60,125$72,123$3,412,500$8,125 MAH ~ WCF what is the value of x?picture will be sent in messages where can I find L1 and L4 ? for missing alternate angles 4p-9=2p+21solve the equation write an inequality for the graph using x for the variable.