Wrong answers only! What is the purpose of sampling water at the water treatment plant. PS IT HAS TO BE ABOUT THE TOPIC

Answers

Answer 1
the purpose is to taste test it obviously

Related Questions

12. Which of the methods of generating electricity does NOT use alternative energy
resources?
a. Burning coal in a power plant
b. Turbines spinning in dam
c. Solar panels taking in light energy
d. Drilling wells to reach hot rocks deep inside the earth

Answers

Answer:

i think its A. burning coal in a power plant

Explanation:

sorry if im wrong but please let me know if this is correct or not

The method of generating electricity that does not use alternative energy resources is burning coal in a power plant.

What are alternative energy resources?

Alternative energy resources are eco-friendly resources that can be used to produce energy.

These are renewable resources and can not be extinct.

These resources do not pollute the earth.

Examples are windmills, solar panels, hydropower, etc.

Thus, the correct option is a. Burn coal in a power plant.

Learn more about energy resources

https://brainly.com/question/11193460

The average molecular weight of proteins encoded in the human genome is about 50,000. A few proteins are very much larger than this average. For example, the protein called titin, which is made by muscle cells, has a molecular weight of 3,000,000. Estimate how long it will take a muscle cell to translate an mRNA coding for an average protein and one coding for titin. The average molecular mass of amino acids is about 110 daltons. Assume that the translation rate is two amino acids per second.

Answers

Answer:

13,636 seconds = 227.3 minutes = 3.79 hours

Explanation:

The titin protein has a molecular weight of 3,000,000 daltons, while the average molecular mass of one amino acid is 110 daltons, so it is expected that this protein is composed of 27,273 amino acids (3,000,000 daltons/110 daltons = 27,272.72). Moreover, and since the translation rate is two amino acids per sec, it is expected that the protein will be synthesized in approximately 3.79 hours (27,272.72/2 = 13,636 seconds = 227.3 minutes = 3.79 hours).

In normal cells the amino acid phenylalanine attaches to tRNAs with the anticodon AAA. The enzyme aminoacyl-tRNA synthetase catalyzes the reaction that attaches the amino acid to the correct tRNA. Assume that a mutation occurs in the aminoacyl-tRNA synthetase enzyme and causes it to attach lysine instead of phenylalanine to tRNAs with the anticodon AAA. What will be the consequence of this mutation for the translation process

Answers

Answer:

Aminoacyl-tRNA bond is hydrolyzed.

Explanation:

The consequence of this mutation for the translation process is the hydrolysis of aminoacyl tRNA bond occur.  If the incorrect amino acid is attached to other molecule as a result of this reaction, the aminoacyl-tRNA bond is hydrolyzed. This incorrect binding of amino acid occur because of mutation in the aminoacyl-tRNA synthetase enzyme that leads to its hydrolysis.

Using the information in this photo, what can MOST LIKELY be learned about the rocks in the illustration?
A)
relative age
B)
absolute age
C)
melting point
D)
average rainfall

Answers

Answer:a

Explanation: got it right on usates

Which RNA molecule is matched with its correct function?

Answers

If Could you show a picture and I could help

Answer:

Which class of RNA is correctly paired with its function? Transfer RNA (tRNA): attaches to an amino acid. What is the difference between the template strand and the nontemplate strand? The template strand is the DNA strand that is transcribed into an RNA molecule, whereas the nontemplate strand is not transcribed

how does the process of translation convert information from a dna code to an rna code?

a. from a DNA code to an RNA code
b. from an amino acids code to a nucleic acid code
c. from an RNA code to a DNA code
d. from a nucleic acid code to an amino acid code

Answers

Answer:B

Explanation:

The nitrogen bases in DNA code for the sequence of amino acids that make up a protein

Answer:

its B

Explanation:

Demonstrate how 200 different cells came from a single fertilized ovum ?​

Answers

Answer:

Humans are not that different from other animals, but vary in the finer detail.

Indeed most amniotes (terrestrial organisms with fetuses surrounded by membrane) work pretty well along the same principles, and there’s also much in common as far back as you want to go, really, on land or in water.

And my next semi-random thought is to say that cellular differentiation, like real estate (apparently), is all about location, location, location. Where the cells are, or where they came from, seems to matter a lot.

Actually, it’s more about layers. Like an onion. Or a cake. (I can’t believe I’m writing this, and apologies to any Shrek fans out there.)

What I mean to say is that some understanding of developmental embryology will help here. To simplify things enormously, our adult cell types ultimately arise from embryonic stem cells. These stem cells are multi-purpose and programmable, or pluripotent in a sense, and capable of making whatever type or form of cell is requested. They just need to be “told” what to do. And just tiny bits of code do exactly that, flipping switches on or off as required, based on cues like orientation, chemical gradients, and proximity.

Now a quick read of the links above will explain it all, but I’ll press on anyway. Out of that initial programming arises our ‘germ layers’, the mesoderm, the ectoderm and the endoderm. We are, after all, triploblastic. 3 layers, get it?

But you knew that.

In case you didn’t, these layers in effect give you a scaffold or more accurately perhaps a tube comprising an inside, outside, and a middle. Where your cells are hanging out in that tube matters, in that they pick up on their location and auto-magically become functionally relevant to that space. In a sense, I mean. Refer back to location, location, location.

Just knowing that pattern of proximity, gradients, and orientation more than simply sets the scene. Whether you work forwards or backwards from there, you will hopefully see that these “germ layers” derive quite simply from a much earlier differentiation, and then complexify. In that sense you have your answer - a complex set of diverse cell types arises by differentiation from an earlier, simpler differentiation. Which sounds a bit clunky when I write it out, but it gives a general idea.

So how does this complicated process happen?

Well, as I mentioned chemical gradients are probably to blame here. And it actually starts before fertilisation, in that the egg itself is already semi-structured and bathed in chemicals with a high-low gradient of some sort. In that sense it’s giving cellular differentiation a head start (there’s a pun there), by setting up some sort of polarity from the beginning. At the very least we get some ends happening, or a top and a bottom if you like.

Now, again simplifying things enormously, your average fertilised egg, or zygote, has by definition a complete set of your DNA ready and waiting, which contains the code for every protein-making gene, plus transcription factors, plus whatever else gets copied for various reasons, including those we haven’t teased out as yet.

Note that those transcription factors really matter. We may have around 20,000 protein-expressing genes, but we also have some 1,500 transcription factors that seem to switch the genes on, off, or arguably and effectively somewhere in between. Well, they work in combination and by that we get a huge amount of variation in expression, and thus our cellular diversity as well.

And all of that DNA goodness is sitting in that zygote, bathed in chemicals that may vary very slightly from top to bottom and side to side as it were, by concentration and by other traits, like temperature. Several such things interact, including orientation and proximity to neighbours, but let’s assert (based on experiments) that the gradient is important, and that it continues to guide the “differentiation” process as new cells are born.

Which is to say that by this process of reading the DNA and expressing only the genes that are switched on by the helpful and gradient-sensitive (say) transcription factors, we get set up to form those 3-D axes and the scaffolding that will guide our cellular replication strategy. Which then produces a result that with each round of replication becomes subtly different and more diverse. Over time the subtlety gives way to more recognisable layers and specialisation in function.

Perhaps not the neatest, clearest explanation but the quickest and least baffling one I can come up with right now. As always, read the links to get a better grasp.

Answer:

During the development of an organism, cells differentiate into many distinct cell types. How does a single fertilized egg cell develop into so many different types of specialized cells? ... They both cannot produce all cells. Multipotent- limited to replacing cells in the tissue where they are found.

A type of tissue called _______ tissue is responsible for communicating between the brain and the rest of the body

Answers

Answer:

Nervous tissue is responsible for communicating between the brain and the rest of the body

Answer:

A nerve/nervous tissue

Explanation:


4. Calculate the kinetic energy of a Hollywood star running from the paparazzi. The star's mass is 45.0 kg, and the star is running at
a velocity of 3.00 m/s.
a) 203 J
b) 303.75 J
c) 405 J
d) 67.5 J

Answers

Answer:

i do not know

Explanation:

Answer:

A

Explanation:

=122

List the four powers of the president​

Answers

Answer: The Constitution explicitly assigns the president the power to sign or veto legislation, command the armed forces, ask for the written opinion of their Cabinet, convene or adjourn Congress, grant reprieves and pardons, and receive ambassadors.

Explanation:

By which process do plants try to avoid
self-pollination?

A. The plant dies to avoid this.

B. The plant detaches the male part of the plant from
itself.

C. They attract pollinators.

D. They have no control over this process of self-
pollination.

Answers

Answer:

it's C. They attract pollinators

11. Fossil fuels are considered nonrenewable resources because of -
a. Where they come from
b. How they are produced
c. How useful they are
d. How long they take to

Answers

The answer is d. How long they take to be renewed, and by that I mean they take years and years to form again.

Non- not
Renewable- replaceable

Fossil fuels take a very long time to be renewed and is not replaceable instantly, which makes it the opposite of hydroelectric power.

Hope this helps!
Good luck.

they enjoy being alone and quiet for a small-time what are they?​

Answers

Answer:

Introverts enjoy being alone because of acetylcholine) this chemical in the brain might induce a kind of happy feeling, for the introvert.

In a process called transpiration, plants get rid of excess water through pores in the leaves called stomata. This excess water is then released into the atmosphere as part of the water cycle. Which of the following terms best describes how the released water enters the atmosphere?
Group of answer choices

precipitation

condensation

capillary action

evaporation

Answers

Answer:

Evaporation

Explanation:

which of the following is an example of the current impact DNA technology has on human health?

Answers

Answer:plants grow

Explanation:te she said so

The total number of chromosomes in an organism is referred to as the
Will mark brainliest

Answers

Answer:

ploidy

Explanation:

Ploidy is the number of complete sets of chromosomes in a cell, and hence the number of possible alleles for autosomal and pseudoautosomal genes.

For a type of pea plant, round seeds (R) are dominant to wrinkled seeds (r). A pea plant
with the genotype Rr is crossed with another pea plant with the genotype Rr. What
percent of the offspring are expected to have wrinkled seeds?
O 100%
O 75%
O 50%
O 25%

Answers

The answer is 25%
When you make a punnet square 1/4 boxes has rr which is the only one that is a wrinkled seed


Helppppppppppppppppp

Answers

for mRNA it’s AUG ACU AGC UGG GGG UAU UAC UUU UAG

The stems of bamboo, a tropical grass, can grow at the phenomenal rate of 0.3 m/day under optimal conditions. Given that the stems are composed almost entirely of cellulose fibers oriented in the direction of growth, calculate the number of sugar residues per second that must be added enzymatically to growing cellulose chains to account for the growth rate. Each D-glucose unit contributes ~0.5 nm to the length of a cellulose molecule.

Answers

Answer:

Approximately 6944 glucose residues are added enzymatically per second

Explanation:

Cellulose is the main structural polysaccharides in plants. It is composed of unbranched glucose monomer units linked to each other by beta 1-4 glycosidic bonds.

The cell wall and stem of plants cells are composed of cellulose fibers. They provide rigidity and support to the plant.

In the given bamboo plant, the enzymatic addition of glucose units to the growing cellulose fiber chains results in the phenomenal growth rate of the bamboo stem.

Since each glucose unit contributes ~0.5 nm to the length of a cellulose molecule, number of glucose units required for daily growth is calculated as follows:

0.5 nm = 10⁻⁹

0.3 m/0.5 x 10⁻⁹ m = 600000000 units of glucose per day

Number of seconds in a day = 24 * 60 * 60 = 86400 seconds

Number of glucose residues added per second = 600000000/86400

Number of glucose residues added per second = 6944.4 glucose molecules per second

Therefore, approximately 6944 glucose residues are added per second

What genome rule does any prokaryotic life on earth commonly does not have?
a. small circular plasmid DNA
b. follows the central dogma DNA>RNA>proteins
c. has thymine in place of uracil on the RNA strand

Answers

Sorry I just need points

Assume that one backbone of a DNA molecule has the sequence given below. A-T-G-G-G-G-G-C-G-A-T-A-T-T-T-T-A-T-C-C-G-A-C-G For this sequence: give the expected sequence of the other DNA backbone. T-A-C-C-C-C-C-G-C-T-A-T-A-A-A-A-T-A-G-G-C-T-G-C give the RNA sequence transcribed from the original DNA backbone. U-A-C-C-C-C-C-G-C-U-A-T-A-A-A-A-U-A-G-G-C-U-G-C give the Amino Acid sequence of the protein built from the original DNA backbone.

Answers

Answer:

DNA: ATGGGGGCGATATTTTATCCGACG

RNA: AUGGGGGCGAUAUUUUAUCCGACG

Protein: MGAIFYPT

Explanation:

Transcription is a genetic process by which the information in a strand of DNA is copied into RNA, typically a messenger RNA (mRNA) sequence which is subsequently used to create a protein by the process of translation. During translation, each triplet of nucleotides or 'codon' corresponds to a specific amino acid. For example, AUG is a codon that codes for methionine (M) and also acts as an initiation codon at the beginning of the nascent polypeptide chain.

Offer a possible explanation why even identical twins are not exactly alike.

Answers

Answer:

Because identical twins are an example of sexual reproduction, which provides different looking offspring

Explanation:

Organisms that are birthed of asexual reproduction are always exactly identical

HELP!!!
Part.2
This is science.

Answers

Answer:

snuflower (common) = Queen anne' s lace

HELPPPP!!!
this is science!

Answers

Butterfly milkweed = Asclepias Tuberosa
Dandelion = taraxacum
Black eyed Susan= Rudbeckia hirta,
Evening primrose=OenThera biennis
Spring forget me not/spring scorpion grass = Myosotis verna.
Daucus = Dacus carota
Annual ragweed = Ambrosia artemisiifolia

(NO LINKS PLEASE I REALLY NEED HELP)

Earth has gone through many cycles of ice ages followed by periods of warmer climate. How might these cycles be related to patterns of solar output and patterns of change in Earth’s motion in space?

Answers

Answer:

They both go back and forth, such as the climate going from hot to warm, and the tectonic plates of the earth going from closed 300 million years ago to spreading far apart now.

Both of them oscillate, as seen by the earth's tectonic plates, which went from being tightly packed 300 million years ago to spreading widely at the moment.

What is tectonic plate?

Tectonic plate is defined as the lithosphere is made up of sections or parts of the upper mantle and crust of the earth. Starting around 4 billion years ago, cooler parts of the Earth's crust were forced downward into the warmer upper mantle, damaging and weakening the surrounding crust. According to the authors, this cycle repeated itself until the weak spots established plate borders.

Slow variations in the Earth's orbit start and conclude these ice eras. However, variations in CO2 concentrations in the atmosphere also play a significant role in driving both cooling at the start of ice ages and warming at their end. During the last ice age, the average global temperature was around 4C lower than it is now.

Thus, both of them oscillate, as seen by the earth's tectonic plates, which went from being tightly packed 300 million years ago to spreading widely at the moment.

To learn more about  tectonic plates, refer to the link below:

https://brainly.com/question/19317822

#SPJ2

Please Help!!!!
Muscles intended for large, powerful contractions contain llx muscle fibers. true or false​

Answers

Answer:

True

Explanation:

Been learning and know

1. If a long tail is a dominant characteristic, in which case is the characteristic of a long tail definitely expressed?

A) when at least one allele contains instructions for a long tail

B) when at least one parent has a long tail

C) when both alleles contain instructions for a long tail

D) when both parents have a long tail


2. What is true of all body cells except sex cells?


A) Each cell type carries chromosomes and genes that identify it as that specific type of cell. For example, skin cells have different chromosomes and genes than muscle cells.


B) Each body cell contains the same number and kinds of chromosomes for that organism. The chromosomes contain the same number and kinds of genes for that individual.


C) While each cell type in the body contains the same kinds of genes, they are organized on different chromosomes depending on the cell type.


D) While each cell in the body contains the same number of chromosomes, each cell type has different genes along those chromosomes.

Answers

Answer:

1. A) when at least one allele contains instructions for a long tail

2. B) Each body cell contains the same number and kinds of chromosomes for that organism. The chromosomes contain the same number and kinds of genes for that individual.

Answer:

A. when at least one allele contains instructions for a long tail

Explanation:

The guy above me Answered.  oh yeah, also have a cheeseburger while your at it. lol

in drosophila melanogaster, the common fruit fly, curved wings "I" and purple eyes "r" are two linked recessive genes found on chromosomes 2. The dominant wild type alleles for those genes are long wings"L" and red eyes "R"
a)describe the expected ratio of offspring in the f2 generation of these genes were located on different chromosomes
b)the results in the f2 generation of these flies were: 40 long winged, red eyes; 40 curved winged, red eyes; 10 long winged, purple eyes, and 10 curved winged, red eyed. how many map units apart are the genes for curved wings and purple eye color?

Answers

Answer:

the other person is right, he had messed up before saying that 60 x 40 = 100, but 60 + 40 = 100. Then I had told him that his answer was wrong and that he should put the answer as 240 instead since 60 x 40 = 240 and not 100.

Explanation:

The expected ratio of offspring in the f2 generation of these genes were located on different chromosomes is 25%

What are chromosomes?

A chromosome is a long DNA molecule with part or all of the genetic material of an organism. In most chromosomes the very long thin DNA fibers are coated with packaging proteins; in eukaryotic cells the most important of these proteins are the histones.

Chromosomes allow DNA to be accurately copied during these cell divisions. So one more time. Chromosomes are found in the nuclei of our cells and allow DNA to be accurately copied during cell division.

Chromosomes are thread-like structures located inside the nucleus of animal and plant cells. Each chromosome is made of protein and a single molecule of deoxyribonucleic acid (DNA).

Learn more about chromosomes:

https://brainly.com/question/21297190

#SPJ2

the children prepared a juice drink for their food festival by dissolving powdered juice in water what kind of mixture did they form? a. colloid b. suspension c. solution d. saturated solution​

Answers

The answer is c Solution

Why is earth considered an open system and a closed system? (Site 1)
O

Answers

Answer:

Open system: has the transfer and exchange of matter and energy in the system's surroundings.

Closed system: has a limit to how much matter is exchanged.

All of Earth's systems are considered open systems, but as a whole, they are closed.

Explanation:

Other Questions
It late, I need help quick Read this excerpt The First Men in the Moon. For my own part a vivid dream has come to my help, and I see, almost as plainly as though I had seen it in actual fact, a blue-lit shadowy disheveled Cavor struggling in the grip of these insect Selenites, struggling ever more desperately and hopelessly as they press upon him, shouting, expostulating, perhaps even at last fighting, and being forced backwards step by step out of all speech or sign of his fellows, for evermore into the Unknowninto the dark, into that silence that has no end. What is the meaning of the bold word, expostulating, as it is used above? examining something arguing against something shouting with joy surrendering to someone PLEASE HELP WE WRITE THIS ESSAY !! IT IS PART OF A TEST SOO PLZZ HELP!!!In at least 150 words, discuss the impact of point of view in "Two kinds." How would the story have been different If told from Amy's mother's point of view? Which statement best explains why the city of Babylon was consider a cultar centaur of the ancient world Complete with the correct form of tener and answer the question.1. _______ ustedes una casa o un apartamento?Nosotros ______2. ______ ustedes una mascota?Nosotros ______3. ______ ustedes una familia grande o pequea?Nosotros ______ what is the answer to question 3 Which statement best reflects the theme expressed in this excerpt?Fear, combined with crowd mentality, leads people to make poor decisions.People should not be blamed for decisions they make in the heat of the moment.A crowd is always more powerful in intense situations than a single person.A group of people is responsible for the actions of each of its members. Lee surveyed the 472 employees at the company with over a decade of experience.Is this sample of the employees at the company likely to be biased?yes / no Martin says that 1/3 + 1/6=2/9 Use the drop-down menus to explain why Martin is incorrect. Martin is incorrect because is incorrect thankyou yaraaaaa and papasgirl19 GIVING BRAINLIEST! What is the y-intercept of y=2x-5 ? Which sentence would be most appropriate for an application for a summer job as a park employee? 100. Global warming has made the Caribbean islands too hot for tourists to continue to visita. correctb. incorrect PLEASE HELP !! ILL GIVE BRAINLIEST *EXTRA 40 POINTS* DONT SKIP :(( .! Acredit given to an author for his or her work is called a(n)citation.copyright.evaluation.permission. The answers is catation. I think it is right sorry if it is not Which of the following statements is FALSE?a.Segregation in America began with the Black Codes after the Civil War and continued in America into the 1960s and 1970s.b.African Americans were never permitted to vote, even after the Civil War.c.The United States Congress declared the Black Codes unconstitutional.d.The Union Army went to the South to enforce emancipation.Please select the best answer from the choices provided (9 +40) + (5 +2b) simplify answer. where did the Vikings establish the most settlements? subtract 13 upon 15 from 1 NEED HELP PLEASE as soon as possible For every 2 minutes that Mandy plays on the computer, she plays outside for 5 minutes. What is the ratio of minutes Mandy plays on the computer to minutes she plays outside? A 5/2 B. 2 to 5 c. 5:2 O D. 2 and 5