Which action does NOT fall within the category of being a good listener?

Question 6 options:

taking notes


nodding your head with speaker


immediately asking questions before the speaker finishes


facing forward towards speaker

Answers

Answer 1

Answer:

Immediately asking questions before the speaker finishes

Explanation:

By immediately asking questions before the speaker finishes shows that the listener is very impatient and doesn't want to hear the speaker completely which is not appreciated by speaker as he/she wants the listener to hear him/her with patience.


Related Questions

What are the examples of fair or unfair practices? in data analytics

Answers

Answer:

Fair practices in data analytics include using data ethically and responsibly, ensuring data accuracy and reliability, and protecting user privacy. Conversely, unfair practices in data analytics include using data for unethical purposes, manipulating data to produce biased results, and using data without the user's consent.

Explanation:

Using data lawfully and professionally, as well as guaranteeing its quality and dependability, are fair practices in data analytics. Using data unethically and altering data to obtain biased results are examples of unfair data analytics practices.

What is data analytics?

Analyzing data collections to identify trends and make judgments about the information they contain is known as data analytics (DA). The study of examining unprocessed data to draw inferences about such information is known as data analytics.

Understanding trends or patterns from the enormous amounts of information being gathered requires the use of data analytics. It aids in performance optimization for enterprises.

Fair practices in data analytics include using data ethically and professionally, as well as ensuring its dependability and quality. Unfair data analytics practices include the use of data unethically and the manipulation of data to produce biased conclusions.

Learn more about data analytics, here:

brainly.com/question/23860654

#SPJ2

a fixed asset should be removed from the accounts except a.when it is sold. b.when it is discarded. c.when it is fully depreciated. d.when it is given away.

Answers

A fixed asset should be removed from the accounts except  c.when it is fully depreciated.  

A fixed asset, also referred to as lengthy-lived belongings or assets, plant and gadget, is a time period used in accounting for assets and assets that may not without difficulty be transformed into cash. constant property are specific from modern-day assets, such as cash or financial institution bills, because the latter are liquid assets.

The term constant asset refers to a protracted-term tangible piece of belongings or system that a firm owns and uses in its operations to generate income. the overall assumption about fixed belongings is that they're predicted to remaining, be ate up, or be transformed into cash after as a minimum 365 days.

Learn more about fixed asset here:https://brainly.com/question/20289326
#SPJ4

Where to get essay writing services in Australia

Answers

Answer:

In my experience Homework Joy is the best website for hiring essay writing services. Since writing is a skill that not everyone possesses thereof, the majority of the students require the assistance of an expert writer.

In case you are also facing difficulties to write and deliver your essay then I highly recommend choosing Homework Joy. In addition, if you have any further questions do not hesitate to reach out to them  visit their official website - homeworkjoy.com

Explanation:

Answer:

ssssssssssssssssssss

This function of marketing is responsible for identifying and reducing risks associated
with marketing decisions. Choose the answer.
O financing
Opricing
O promotion
Orisk management

Answers

This function of marketing is responsible for identifying and reducing risks associated with marketing decisions is risk management. So risk management is correct option of the given statement.

How does risk management work?

IT risk management refers to the use of risk management techniques to handle IT threats. Procedures, guidelines, and tools for evaluating possible risks and weaknesses in IT infrastructure are part of IT risk management.

What function does risk management play in general?

The process of discovering, evaluating, and managing risks to people, assets, liabilities, and income is known as risk management. The ultimate purpose of risk management is the preservation of the organization's material and human resources to ensure the smooth continuation of its business operations.

To know more about risk management visit:

https://brainly.com/question/4680937

#SPJ13

Answer:

D. Risk Management

Explanation:

during the __________ era, the prevalent business philosophy turned from an emphasis on production to an emphasis on advertising and selling.

Answers

During the Selling Era, the prevalent business philosophy turned from an emphasis on production to an emphasis on advertising and selling.

A business's philosophy is the set of guiding principles it adheres to in order to accomplish its main objective. It encompasses the company's principles and grounds it amidst ups and downs. It ought to fit with the character, purpose, and vision of the brand. It highlights the company's actions, choices, and culture. You want your business philosophy to be inspiring, practical, and applicable to all company endeavours and divisions.

Production is the process of combining different material and immaterial inputs to create something that is intended for consumption. Production is the act of creating a result, a good or service that has value and enhances people's utility.

learn more about business philosophy here

https://brainly.com/question/10815385

#SPJ4

Suppose a person who is developing a card game crowdfunds $40,000 and holds this as cash for future expenses. If this $40,000 comes from donors' checking accounts, by how much will the money supply fall if the reserve ratio is 10 percent?
A. The Money Supply will decrease by $___.
I've tried 4000, 40000, 36000, 44000, 400000, and everything else you can think of. Someone please help answer this!

Answers

According to the given details, the money supply will decrease by $400,000

Money supply

Money supply refers all the currency and other liquid instruments in a country's economy on the date measured.

Given,

Suppose a person who is developing a card game crowdfunds $40,000 and holds this as cash for future expenses.

Here we need to find the decreasing rate in money supply.

While we looking into the given question, we have identified the following values,

Account balance = $40,000

Reserve ratio = 10%

Now, the decreasing rate is calculated as,

Decrease rate = Account balance[1/reserve ratio]

Now, we have to apply the values on the formula, then we get

Decrease rate  = 40000[1/0.10]

When we simplify it, then we get the decrease rate as,

Decrease rate =  $400,000

Therefore, the money supply will decease by $400,000.

To know more about Money supply here.

https://brainly.com/question/28891105

#SPJ1

the party making the promise to pay the promissory note is the? a.maker. b.payee. c.lender. d.assignee.

Answers

Answer:

PAYEE

Explanation:

A promissory note is a legal instrument in which the first party (maker) promises to pay a specific amount to another (payee) at a specific time with specific terms and conditions.

For example: I want a business loan (promissory note). I go to the bank. They write up the paperwork. The loan officer (maker) agrees to pay me the $3000 at 6% for the next 3 years. I sign the paperwork stating I accept the loan (I am now the payee).

The stable behavioral and psychological characteristics responsible for a person's identity are known as _______

Answers

The stable behavior and psychological characteristics responsible for a person's identity are known as Personality.

Behavior refers to the assortment of behaviors and etiquette that people, living things, systems, and artificial entities exhibit in a given context. These systems may consist of both the inanimate physical world and other systems or species. It is the system's or organism's calculated reaction to different inputs or stimuli, whether internal or external, conscious or unconscious, overt or covert, and voluntary or involuntary.

From the standpoint of behavior informatics, a behavior is made up of an actor, an operation, interactions, and attributes. This can be shown as a vector of behavior.

People's health is greatly influenced by their behavior, and many behavioral patterns are intricately linked to their socioeconomic status.

To learn more about behavior visit here:

brainly.com/question/24565314

#SPJ4

What form of nonverbal communication is being used when a person sits at a boardroom table with their belongings neatly stacked close to them?

Question 5 options:

posture


appearance


tidiness


space

Answers

Answer:

The answer is C. tidiness because the person with their belonging decided to tidy their space to make it look clean and organized when sitting at a boardroom table.

Explanation:

Prioritize the following tech issues:
a. Issues that affect a group of customers
b. Issues preventing revenue
c. Issues that affect all customers.
d. Issues that affect back end customer support, no customer facing impact
e. Issues that affect back end customer support, customer facing impact.
f. Issues that have a probability of resulting in a dispute or consumer affairs complaint.

Answers

The Prioritization of the tech issues is using point 1, 2, 3, 4 and 5 with point 5 meaning high priority and point one, low priority.

a. Issues that affect a group of customers - 3

b. Issues preventing revenue - 5

c. Issues that affect all customers. -5

d. Issues that affect back end customer support, no customer facing impact -3

e. Issues that affect back end customer support, customer facing impact-3

f. Issues that have a probability of resulting in a dispute or consumer affairs complaint - 2

Prioritization strategy: what is it?

Making lists, choosing which things to perform that day, and completing each activity in order of urgency are all examples of prioritization strategies you can use to fulfill your daily work responsibilities. By putting them into practice, you can get more done in less time and have more time for less important activities.

Therefore, Prioritization typically involves a group procedure in which organizational or concerns are ranked according to their considered priority or significance. Setting priorities for difficulties is a crucial procedure since it helps a company decide which problems to concentrate its limited resources on.

Learn more about Prioritization from

https://brainly.com/question/23077766
#SPJ1

1. What is the future value of £125, if it were invested today at a compound interest rate
of 4% for a period of 8 years?
A. £91.34
B. £125.00
C. £165.00
D. £171.07
E. £1844.74

Answers

Future value would be £171.07 with compound interest

Therefore option d. is correct

To calculate future value of a amount formula given below is used

FV = P( 1 + i)^n

where P is Principal, i is rate of interest and n is number of term

FV = £125 (1 + 0.04)^8

FV = £125 x 1.3685

FV = £171.07

What is compound interest?

Compound interest simply refers to the fact that an investment, loan, or bank account's interest accrues exponentially over time as opposed to linearly over time.

Compound interest, also known as interest on principal and interest, is the practise of adding interest to the principal amount of a loan or deposit.

To know more about compound interest refer

https://brainly.com/question/24274034

#SPJ9

Describe the marketing mix to reach the desired marketing objectives

Answers

The marketing mix is the collection of marketing tools that a company employs to achieve its marketing objectives in a specific market. There are various components of the marketing mix, but McCarthy's 'FOUR Ps' are universally accepted. These 4 Ps are ‘Product, Price, Place, Promotion’

Product- A product is defined as "anything of value" that is offered for sale in the market. The concept of product refers not only to the physical product but also to the benefits provided by the product from the consumer's perspective. The concept of product also includes what is offered to the customer in terms of after-sales services, handling complaints, availability of spare parts, and so on

Price- Price is the amount of money which the customers have to pay to obtain the product. It is a very crucial element of marketing mix as customers are highly price sensitive, and level of price affects the level of demand. Marketers have not only to decide about objectives of price setting but to analyze the factors determining the price and fix a price for the firm’s products.

Place- Place, also known as physical distribution, refers to activities that make a company's products available to its target customers. It also includes decisions about which intermediaries to use and how to support them through discounts, promotional campaigns, and so on.

Promotion- Promotion refers to all activities that communicate the availability, features, benefits, and so on of a product to potential customers and persuade them to purchase it. Organizations engage in a variety of promotional activities and spend significant money promoting their products through a variety of tools such as advertising, personal selling, sales promotion techniques, and public relations.

A company's success is determined by how well these elements are combined to provide superior value to customers while meeting sales and profit goals.

For more information on marketing mix visit:

https://brainly.com/question/28395764

#SPJ9

Create a simple symbol to help explain each of the three types of loans that banks commonly
make: commercial loans, consumer loans, and mortgage loans. Write one or two sentences
explaining who would typically take our each type of loan and what the money would be used
for.

Answers

Borrowing cards are a type of unsecured revolving credit with higher interest rates. Commercial loans with terms of one to three years. Commercial loans with a longer term are typically secured by real estate or other large assets.

What is commercial loans?

A commercial loan is arranged between a bank and a company and is used to pay for both operating expenses and capital investments. Collateral, such as real estate or machinery, is often required for commercial loans. Financial statements are typically required from businesses to demonstrate their capacity to pay.

Simply enough, "commercial" is another synonym for "business." Therefore, as opposed to a consumer loan, a commercial loan is only a business loan. A business loan might be used, for instance, to purchase both the building and a restaurant.

An mortgage loan used to buy, refinance, or repair a business property is known as a commercial real estate (CRE) loan. Numerous traditional and internet lenders offer CRE loans with slightly variable terms, fees, and eligibility requirements.

Loans that aren't typically managed by the real estate or consumer loan departments are referred to as "commercial loans" in common parlance. Commercial or business loans are typically one of a national bank's most significant assets when it comes to asset distribution.

Learn more about commercial loans, here

https://brainly.com/question/27915139

#SPJ1

Stam Company shows the following costs for three jobs worked on in April. Job 306 Job 307 Job 308 Balances on March 31 Direct materials (in March) $ 33,600 $ 41,900 Direct labor (in March) 24,600 20,300 Applied overhead (March) 12,300 10,150 Costs during April Direct materials 139,600 226,900 $ 102,300 Direct labor 94,200 161,500 107,300 Applied overhead ? ? ? Status on April 30 Finished (sold) Finished (unsold) In process Additional Information Raw Materials Inventory has a March 31 balance of $91,500. Raw materials purchases in April are $504,600, and total factory payroll cost in April is $388,300. Actual overhead costs incurred in April are indirect materials, $52,300; indirect labor, $25,300; factory rent, $34,300; factory utilities, $21,300; and factory equipment depreciation, $55,600. Predetermined overhead rate is 50% of direct labor cost. Job 306 is sold for $650,000 cash in April.

Answers

Based on the cost of production by Stam Company, the overhead rate which is applied to the jobs are:

Data and Calculations:

                                                       Job 306           Job 307        Job 308

Balances on March 31

Direct materials used (in March)    $33,600         $41,900

Direct labor used (in March)           $24,600        $20,300

Overhead applied (March)              $12,300         $10,150

Costs during April

Direct materials used                     $139,000      $226,900     $102,000

Direct labor used                            $94,200       $161,500       $107,300

Overhead applied                           $55,600       $77,500       $52,500

                             ($94,200 × 50%)  ($161,500 × 50%)  ($107,300 × 50%)

Job 306 - $47,100

Job 307 - $80,750

Job 308 - $53,650

The overhead rate applied for Job 306 in April is:

= Direct labor cost x 50%

= 94,200 x 50%

= $47,100

The overhead applied for Job 307 in April is:

= 161,500 x 50%

= $80,750

The overhead for Job 308 in April is:

= 107,300 x 50%

= $53,650

Hence, based on the cost of production by Stam Company, the overhead rate applied to the jobs are calculated above.

The given question is incomplete, the complete question is-

Stam Company shows the following costs for three jobs worked on in April. Job 306 Job 307 Job 308 Balances on March 31 Direct materials (in March) $ 33,600 $ 41,900 Direct labor (in March) 24,600 20,300 Applied overhead (March) 12,300 10,150 Costs during April Direct materials 139,600 226,900 $ 102,300 Direct labor 94,200 161,500 107,300 Applied overhead ? ? ? Status on April 30 Finished (sold) Finished (unsold) In process Additional Information Raw Materials Inventory has a March 31 balance of $91,500. Raw materials purchases in April are $504,600, and total factory payroll cost in April is $388,300. Actual overhead costs incurred in April are indirect materials, $52,300; indirect labor, $25,300; factory rent, $34,300; factory utilities, $21,300; and factory equipment depreciation, $55,600. Predetermined overhead rate is 50% of direct labor cost. Job 306 is sold for $650,000 cash in April.

Enter debits before credits. Transaction General Journal Debit Credit a. Record entry Clear entry View general journal 4. Prepare a schedule of cost of goods manufactured for the month end April 30. Stam Company Schedule of Cost of Goods Manufactured For Month Ended April 30 Total manufacturing costs Total cost of work in process Cost of goods manufactured.

To learn more about the overhead rate here:

https://brainly.com/question/15187056

#SPJ1

how do supply and demand work together to influence the price of a product

Answers

When supply exceeds demand for a good or service, prices fall. When demand exceeds supply, prices tend to rise. They have a inverse relationship.

In strongly decentralized organizations, even the lowest-level managers can make decisions.

a. True
b. False

Answers

Answer: True.

Explanation:In strongly decentralised organisations, even the lowest-level managers can make decisions.

a. Decentralised operations often allow the lower-levels of management to make decisions because they are most familiar with the day-to-day operations.

b. In decentralised organisations, decision-making authority is spread throughout the organisation. Lower-level managers are empowered to make decisions which can increase motivation and job satisfaction.

c. Operations are able to respond quickly to customers and changes in the environmentin a decentralised organisation because there are fewer managers that must beconsulted before a decision is made.

Learn more about decentralised organisation on link below

https://brainly.com/question/21728108?referrer=searchResults

#SPJ4

Monetarism Which of the following is a position held monetarists?
The economy is unstable; wages and prices are inflexible.
Changes in the velocity of money are unpredictable.
Aggregate demand depends on money velocity but not on the money supply.
The short-run aggregate supply curve slopes upward.

Initially, the economy is in long-term equilibrium. Suppose there is an increase in velocity-that is, there is an increase in the average number dollar is spent to buy goods and services.
Show the long-run effect of this change according to the monetarist view, ceteris paribus, by dragging one or both curves on the graph below.

Answers

The short-run aggregate supply curve slopes upward.

What the graph depicts?The aggregate supply curve displays the amount supplied in the market at various price points. While supply is inelastic in the short term, it is elastic over the long term.Money: The same factors that affect the supply and demand of commodities also affect the supply and demand of money. The assumption about the rate at which money is traded in an economy is known as the velocity of money. The frequency with which money is transferred from one person to another. It is the rate of economic spending by both consumers and corporations.Therefore, The short-run aggregate supply curve slopes upward.

To learn more about supply curve, refer to

https://brainly.com/question/11717727

#SPJ4

comment on the ethics exhibited by amy and the possible consequences of her actions. how does the merchandising company account for the suits that amy returns? (what journal entries are required?)

Answers

It is extremely unethical on their part of Amy to purchase a suit from the merchandising company and then return it after a week wherein she wears the suit for her event and then returns to the company to get a full payment refund. Ethically, she can only return the suit that she did not like for some reason or it has some other problems (like fitting, etc) however in no circumstances it is ethical to return a suit after using it for one party. This unethical practice can also land Amy in trouble in case the merchandising company discovers her intentions. If they come to know that suit was already used by her during a function and then returned they could certainly sue them for the breach of sale and return of goods contract.

Unethical: “A scholar used plagiarism on their very last written project to get a better grade” This is unethical as it is going towards social norms and the bulk of humans might discover this act unacceptable.' Unethical' defines as something this is morally incorrect, even as something being 'unlawful' way it's far from the law. In an unlawful act, the decision-making element is the law.

For an unethical act, the finding out the agent is the man's personal conscience. An unethical deed can be towards morality however now no longer towards the law. The unethical behavior of the strength agencies is disgraceful. But lately, we've got visible simply what the value of unethical behavior can be.

Learn more about unethical here

https://brainly.com/question/24518056

#SPJ4

Please help me look for the answer to this question!!!
On July 1, 2019, Sheridan Company purchased new equipment for $80,000. Its estimated useful life was 8 years with a $12,000
salvage value. On December 31, 2022, (before calculating annual depreciation) the company estimated that the equipment's
remaining useful life was 10 years, with a revised salvage value of $5,000
(what is in the red box is incorrect)

Answers

The depreciation expense entry on Dec 31, 2019 is

DR Depreciation Expense $4250

CR Accumulated Depreciation $4250

The depreciation expense entry on Dec 31, 2020 is

DR Depreciation Expense $8500

CR Accumulated Depreciation $8500

Revised Annual depreciation to be charged on Dec 31, 2022 is $5375

The depreciation expense entry on Dec 31, 2022 is

DR Depreciation Expense $5375

CR Accumulated Depreciation $5375

Balance Accumulated Depreciation as on Dec 31, 2022 is $26,625

What is Depreciation?

Depreciation is a systematic allocation of cost of an asset over the useful life. Depreciation is charged monthly or annually according to the policy. Depreciation can be calculated using straight line method or reducing method, these two are common methods of you of calculating depreciation.

In the case scenario provided in the question the depreciation was initially charged on eight years while the revised depreciation estimated that the useful life of the asset remaining is 10 years. The asset value is first deducted from the salvage value of the asset then divided by the number of estimated useful life. Revised depreciation can be calculated by taking the original amount of the asset minus accumulated depreciation till date minus salvage value then divide into revised useful remaining life of the asset.

Learn more about depreciation at https://brainly.com/question/27386044

#SPJ1

What is one advantage of a trade school education?

A. Statistically, your lifetime earnings will be higher than a college
graduate's.

B. You will have a greater selection of electives.

C. It is less costly than attending a four-year college.

D. You can postpone getting a job longer.

Answers

Answer:

c

Explanation:

it is making me type more

Question 4 of 20
How is the equilibrium price found using a supply and demand graph?
A. It is found at the midpoint of the supply curve.
B. It is found at the midpoint of the demand curve.
C. It is found where the supply curve meets the demand curve.
D. It is found at the lowest point of the supply curve.
SOBMIT

Answers

Answer:

C.

It is found where the supply curve meets the demand curve

Look up examples of different warning labels for things such as food and small appliances. Observe features that stand out about these warnings (colors, shape, pictures, information, and so on). After looking at a few and seeing how they identify dangers or warn against potential hazards, develop your own safety warnings for a product that you use.

Answers

Danger, Caution, Notice, Instruction, Fire and Biohazard are a few examples of different warning labels for things such as food and small appliances.

Warning labels are required by law on many dangerous products, such as chemicals and medications. They are also often found on products that are potentially harmful if used incorrectly, such as power tools and electrical appliances. Even some food products now come with warnings, such as those that contain allergens.

It's always important to use caution and common sense when using any product, even if it doesn't have a warning label.

To know more about warning labels, click here.

https://brainly.com/question/14640188

#SPJ1

Answer:

I will create the following warning labels for my cell phone:

Label 1: An image showing a dripping cell phone with an “x” marked on it

Label shape: Rectangle

Warning: “Do not let water seep into this phone. Water will damage the internal parts of the cell and cause malfunctioning.”

Label 2: An image showing a charger plugged of a cell phone

Label shape: Triangle

Warning: “Charge your cell phone regularly for longer battery life.”

Label 3: An image showing a pair of earphones with an “x” marked on them

Label shape: Square

Warning: “Avoid using earphones or answering phones while crossing roads.”

Explanation:

Edmentum Answer

The following information applies to the questions displayed below.]

Clothing Frontiers began operations on January 1 and engages in the following transactions during the year related to stockholders’ equity.

January 1 Issues 600 shares of common stock for $38 per share.
April 1 Issues 100 additional shares of common stock for $42 per share.

Answers

The following entries will be made for Clothing Frontiers

Jan 01

DR Cash $22,800

CR Common Stock $600

CR Additional Paid in capital $22,200

Apr 01

DR Cash 4,200

CR Common Stock $100

CR Additional Paid in capital $41,00

What is Journal Entry?

Journal entry is the type of recording transaction that have occurred in a company, these journal entries are also known as the double entry for their nature of having impact on different account. The journal entry is the initial step for the transaction to be recorded. At the end of the month trial balance is maintained and then Income statement and balance sheet are prepared.

The Common stock is credited with the par value of the stock sold while the difference of the cash received for the sale of cash and the par value is credited to the additional paid in capital account.

Learn more about Journal entries at https://brainly.com/question/27011354

#SPJ1

2. Unemployment is likely to increase when

a. Aggregate demand is high
b. There is a period of moderate inflation
c. Workers voluntarily leave their jobs for new ones
d. The supply of goods is less than the economy demands

Answers

Unemployment is likely to increase when There is a period of moderate inflation

Inflation and unemployment have been historically maintained in  an inverse relationship which is  represented by the Phillips curve. Low levels of unemployment generally and typically corresponded with the  higher inflation whereas high unemployment always corresponded with lower inflation and even deflation also.

Inflation is the term which is used to describe the drop of a currency's purchasing power over a fixed time. Unemployment is the situation where the economists refer to when the number of jobless people which are willing to work in the given time  exceeds the supply of jobs in the workforce

To know more about inflation here:

https://brainly.com/question/29347039

#SPJ1

A student paraphrases the ideas of an expert criminologist in her essay on crime and deviance. Should she:

Answers

Based on the essay writing technique and standards, when a student paraphrases the ideas of an expert criminologist in her essay on crime and deviance. she should cite the source and reference it.

Paraphrasing ideas in the essay

The act of paraphrasing different ideas when writing an essay as a student is a very common thing. However, when paraphrasing, it is always expected that the writer cites the source and makes a reference to the original person who jas the idea to avoid plagiarizing.

Three methods of paraphrasing are the following:Acknowledging paraphrasingOrganizing paraphrasingAbstracting paraphrasing

Also, to make a proper paraphrasing, one needs to do the following:Ensure to use synonymsAlways use the different word formMake sure to change from active to passive.Always try and change the word order.Make use of a combination of techniques.

Hence, in this case, it is concluded that when a student paraphrases the ideas of an expert criminologist in her essay on crime and deviance, she should cite the source and reference it.

Learn more about Paraphrasing here: https://brainly.com/question/24729251

#SPJ1

An example of statistical inference is

Answers

For example, we might be interested in the mean sperm concentration in a population of males with infertility. In this example, the population mean is the population parameter and the sample mean is the point estimate, which is our best guess of the population mean.

Which of the following taxpayers will NOT be eligible for a qualified business income (QBI) deduction for the business activity described?
Alejandro is a sole proprietor. He actively participates in his business and has a net profit of $60,000 this year.
Lindsay owns 10% of the shares of Gestures, Incorporated, an S corporation. She does not perform any services for the company. Her share of ordinary income is $3,000 this year.
Jeff owns 20% of the shares of Woodbury, Incorporated, a C corporation. He occasionally performs services and receives Form W-2 for his earnings.
Gina is a general partner of Business Case, a partnership. She actively participates in the business operation. Her share of ordinary income is $45,000 this year.

Answers

The taxpayer that will NOT be eligible for a qualified business income (QBI) deduction for the business activity described is option C: Jeff owns 20% of the shares of Woodbury, Incorporated, a C corporation.

Which business models are acceptable for Qbi?

QBI is the total of all qualified items of income, gain, deduction, and loss from all qualified trades or businesses, including partnership, S corporation, sole proprietorship, and certain trust income.

A partnership, S corporation, or sole proprietorship that generates qualified business income (QBI) may be eligible for the QBI deduction. You are not permitted to deduct any income that you receive from a C corporation.

Therefore, The net amount of qualified items of income, gain, deduction, and loss from any qualified trade or business, including partnerships', S-corporations', sole proprietors', and certain trusts' income, is known as QBI. Hence option C is correct.

Learn more about business income from

https://brainly.com/question/14277159
#SPJ1

people who purchase goods or services from a business are called

Answers

Answer:

Customer.

Explanation:

A customer is a person who buys either a good or a service. Customer is more common than shopper, and it is used more in business contexts than shopper is. Shops were lowering prices to attract more customers.

I am pretty sure a customer

Give an example of an industry with monopolistic competition. (Remember that this is an industry structure, and not a specific business within that industry.) Explain the benefits or detractions of this type of competition.

Answers

There is monopolistic rivalry in the restaurant, hair salon, home products, and clothing industries. To sell, advertise, and set prices for products like dish soap and hamburgers, numerous competitor enterprises compete.

There is monopolistic rivalry in the restaurant, hair salon, home products, and clothing industries. To sell, advertise, and set prices for products like dish soap and hamburgers, numerous competitor enterprises compete. Not just in product markets, but also in labour markets, competition is essential. An illustration of a monopolistically competitive market is the restaurant sector, which is present nationwide. Most places have a large number of businesses, all of which are unique, and entry is simple.

To learn more about monopolistic, click here.

https://brainly.com/question/14055453

#SPJ1

When performing a nail form application procedure, how do you know if the form is perfectly positioned?

Answers

When the form does not crowd the hyponychium and fits snugly under the free edge.

The hyponychium: what is it?

The skin just below the free edge of your nail is called the hyponychium. It is close to your fingertip, just beyond the distal end of your nail bed.

What lies beneath the nail's free edge?

The epithelium beneath the nail plate, between the free edge and the skin of the fingertip, is the hyponychium, also known as the "quick."The nail bed is protected by this seal.

What is the hyponychium's structure?

The hyponychium is a special structure that prevents the nail plate from physiologically detaching from the nail bed and seals the subungual space. Most of the matrix is covered by the proximal nail fold. Its free end shapes the fingernail skin which seals the nail pocket or parkway.

Learn more about hyponychium here:

https://brainly.com/question/22100313

#SPJ4

Other Questions
Devin owes $26,000 in students loans for college. The interest rate is 8.75% and the loan will be paid off over 15 years. How much will Devin pay altogether?$60,125$72,123$3,412,500$8,125 MAH ~ WCF what is the value of x?picture will be sent in messages where can I find L1 and L4 ? for missing alternate angles 4p-9=2p+21solve the equation write an inequality for the graph using x for the variable. Evaluate the determinant.7 3 28 2 76 8 5A) 212B) -464 -212D860 How did the French respond when the United States refused to pay debts owed to France. Question 4Below is the CODING STRAND of a small gene that codes for a peptide. Assume the gene has atraditional start codon.How many amino acids long is the peptide if we assume traditional start and traditional stopcodon?5' AATCCGTATCTATGACCGTTTGGAAACACTAAGCGGTACTC 3'3569 Which equations represent a linear function? Select two. a. y = x-1 b. y = 4.5 C. 3x 4y = 2 d. 5x2 = 10y e. y = 1/2x2 +6 suppose s and t are mutually exclusive events. find p (s or t) if p(s)=29% and p(t)=49% There are a total of 50 questions worth 130 points on Chenille's history exam. Someof the questions are worth five points each, and the other questions are worth twopoints each. Which of the following systems of equations could be used todetermine F, the correct number of five point questions, and t, the correct numberof two point questions answered correctly? 4. __H2SO4 + __Cr(OH)3 --> __Cr2(SO4)3 + __H2OYou have 4 moles of H2SO4. How many moles of H2O are produced? Which of the following is equal to ? 1/5^-2 ) What is the most notable difference between particles in the solid phase and the liquid phase? Express the following as an algebraic function of x.sin(sin-'(x) cos-'(x)) Convert 15 gal to quarts List the structure and functions of the main organs of the United Nations Question 4 please . Using a graphing utility (geogebra) to graph the function Identify the units you would expect for the given quantity.The price of a bottle of French perfume, found by multiplyingthe unit price of the perfume in euros per milliliter by thevolume of the bottle in milliliters. I have that sweatshirt for 10 years