Translation in biology is defined as the process of turning nucleic acid information into amino acids. The study of genes, genetic variants, and heredity is part of the molecular foundation of inheritance. The molecular foundation of heredity consists of DNA, RNA, and genetic code
Explanation:
Translation in simple terms is turning the transcripted mRNA codons or sequences into amino acids.
Transcription in simple terms is DNA codons or sequences getting converted into mRNA codons or sequences.
Both of these together are called Gene Expression.
When a fruit fly embryo first begins to develop, a large cell is generated that contains over 8000 genetically identical nuclei. Whatis most likely responsible for this result?
When a fruit fly embryo first starts offevolved to develop, a big mobileular is generated that carries over 8000 genetically same nuclei then the embryo passes thru more than one rounds of the mobileular cycle, however cytokinesis does now no longer arise in the course of the M phase.
Cytokinesis starts offevolved in anaphase and results in telophase, accomplishing crowning glory as the following interphase starts offevolved. The first seen extrade of cytokinesis in an animal mobileular is the surprising look of a pucker, or cleavage furrow, at the mobileular surface.
Cytokinesis failure results in each centrosome amplification and manufacturing of tetraploid cells, which might also additionally set the degree for the improvement of tumor cells. However, tetraploid cells are plentiful additives of a few ordinary tissues inclusive of liver and heart, indicating that cytokinesis is physiologically regulated.
Learn more about nuclei visit: https://brainly.com/question/27960151
#SPJ4
you work in a lab that studies aminoacyl-trna synthetases. you are studying an aminoacyl-trna synthetase that normally recognizes the anticodon guc. you are able to mutate the anticodon binding region of the enzyme so that it instead recognizes the anticodon ugu. what will be the effect on protein synthesis?
During protein synthesis, when an amino acid is added to a developing polypeptide, a tRNA anticodon couples with its matching codon on the mRNA molecule, guaranteeing that the correct amino acid is put into the polypeptide.
What is aminoacyl-tRNA synthetases?An aminoacyl-tRNA synthetase, also known as a tRNA-ligase, is an enzyme that connects the correct amino acid to the proper tRNA. It accomplishes this by catalyzing the transesterification of a particular cognate amino acid or its precursor to one of its compatible cognate tRNAs, resulting in the formation of an aminoacyl-tRNA.
Aminoacyl-tRNA synthetases (aaRS) are enzymes that catalyze the attachment of a specific amino acid to the 3' end of its corresponding tRNA. They do this by creating an energy-rich aminoacyl-adenylate intermediate of the corresponding amino acid, which is then transferred to the tRNA.
Learn more about protein synthesis:
https://brainly.com/question/16305501
#SPJ1
the complement system refers to: proteins present on macrophages that recognize foreign proteins. proteins that are activated when histamine levels increase. proteins circulating in the blood that are activated by opsonization. proteins circulating in the blood that are activated by antibodies or molecules on pathogens.
Proteins in the blood that are activated by pathogens' compounds or antibodies.
A big, Y-shaped protein known as an immunoglobulin (Ig), sometimes known as an antibodies (Ab), is used by the immune system to identify and eliminate foreign invaders like dangerous bacteria and viruses. The pathogen molecule that the antibody specifically recognizes as an antigen. These two structures can attach to one another precisely because each "Y"-shaped tip of an antibody has a paratope (like a lock) that is particular for one particular epitope (like a key) on an antigen. A pathogen or an infected cell can be neutralized by an antibody directly through this binding mechanism, or it can be marked for attack by other immune system components
Learn more about antibodies here:
https://brainly.com/question/27931383
#SPJ4
which experimental results would demonstrate that central pattern generators are involved in producing the muscle contractions involved in rhythmic movement?
The experimental result that displayed the central pattern generators' involvement in muscle contractions is that 'an insect in which the sensory afferents from the wings have been cut can fly', which suggests that option C is the right answer.
Central pattern generators are neuronal circuits which when activated produce rhythmic motor patterns such as walking, breathing or flying etc. in the absence of sensory signals. Muscle contraction refers to the activities such as tightening, shortening, or lengthening of muscles when some activity is performed by the body. It is caused due to the information signal received by the brain and then returned back to site of stimuli. The experiments conducted displayed that a deafferented locust could generate rhythmic flight motor patterns in response to non-rhythmic stimulation of the nerve cord.
Learn more about Central pattern generators at:
brainly.com/question/15565886
#SPJ4
To refer to complete question, see below:
Which experimental results would demonstrate that central pattern generators are involved in producing the muscle contractions involved in rhythmic movement?
a. A cat whose cerebral cortex has been removed can walk and run on a treadmill.
b. A cat whose cerebral cortex has been removed has impaired balance on a treadmill.
c. An insect in which the sensory afferents from the wings have been cut can fly.
d. An insect in which the sensory afferents from the wings have been cut has an unusually slow wingbeat frequency.
how does the cell membrane work
Answer:
The cell membrane, also called the plasma membrane, is found in all cells and separates the interior of the cell from the outside environment. The cell membrane consists of a lipid bilayer that is semipermeable. The cell membrane regulates the transport of materials entering and exiting the cell.
Explanation:
Look at DNA, a polymer, and nucleotide, a monomer, on the nucleic acid page. There are sugar molecules within these structures. How many sugar molecules are in DNA and the nucleotide?
Answer: 1 sugar molecule
Explanation:
The basic building block of DNA is called a NUCLEOTIDE. A nucleotide is made up of one sugar molecule, one phosphate molecule and one of the four bases.
nervous system effector cells group of answer choices consist of sensory cells. provide automatic responses to stimuli. are white blood cells found in the circulatory system. include muscle cells and gland cells.
Muscle cells and gland cells are effector cells of nervous system.
The various types of cell present in nervous system that actively responds to a stimulus and effects some change is termed as effector cells. Examples of effector cells are- The muscle cells, gland cells or organ cell. Which are capable of responding to a stimulus at the terminal end of an efferent nerve fiber.
Sensory cells are different from effector cells. Sensory cells detect information (like- sounds, light, touch, smell, taste, and temperature) receptors present on their surface. White blood cells are found in circulatory system and are also a part of immune system that provide protection to the body from various infection. Rapid automatic response to a stimulus is called reflex.
To learn more about effectors visit the link- https://brainly.com/question/14014965
#SPJ4
[Anatomy, muscles] On the pinky side, to bring back to anatomical position, from a clenched fist
(The answer is 3 words long, it must fit in the spaces I drew in the image)
Between the hand's bones is where the interossei muscles start. There are three palmar interossei and four dorsal interossei. The dorsal interossei allow us to stretch our fingers apart whereas all interossei bend the MCP joints. The interossei on our palms bring our fingers together.
The first and secondhand bones serve as the origin of the greatest dorsal interosseous muscle. When a patient has severe cubital tunnel syndrome because of ulnar nerve injury, it is frequently the first muscle to shrink. It creates the shape between the thumb and index finger when looking at the top of the hand. It draws the thumb towards the index finger as well as dragging the index finger away from the middle finger.
To know more about muscles visit:
https://brainly.com/question/9883108
#SPJ1
How did the phytoplankton change during the El Nino events of 1992-93, 1997-98, and 2015-16?
The phytoplankton levels dropped enormously during the El Nino events.
Phytoplankton are the autotrophic organisms of the aquatic habitat. They are the beginners of the aquatic food chains. Phytoplankton belong to the category of algae. The species have the capability of buoyancy and float in the upper regions of the sea where sunlight can reach to them.
El Nino was the phenomenon where the temperature of the sea surface went unusually high. This lead to the occurrence of droughts, floods, and several other calamities. Since the temperature of the sea increased, the conditions turned unfavorable for the blooming of phytoplankton and that is why their population reduced.
To know more about El Nino, here
brainly.com/question/18307318
#SPJ1
How has the carbon cycle changed between the Pre-Industrial and Post-Industrial eras?
Answer: It converts corbon to dox
Explanation:
during gene expression, when dna is being transcribed into rna, the non-coding sections are removed. the remaining coding segments are connected. this process is called
As DNA is being translated into RNA during gene expression, the non-coding regions are cut out by a procedure known as RNA splicing.
What does place when DNA gets translated into RNA?In the nucleus, transcription occurs. It constructs an RNA molecule from a template made of DNA. Translation takes place when RNA travels from the nucleus to a ribosome in the cytoplasm. A protein is created during translation by reading the genetic code in mRNA.
What happens when you're transcribing?The information contained in a gene's DNA is transferred to RNA (ribonucleic acid), a molecule comparable to DNA, in the cell nucleus during transcription. Both RNA and DNA are composed of a series of units known as nucleotides.
To know more about rna visit:-
https://brainly.com/question/20914096
#SPJ4
Why is drinking milk not enough to make the bone strong?
Answer:
It's the calcium IN the milk that makes bones strong.
Explanation:
^^
How did Nautiluses developed jet propulsion. Why was it envolutionarily beneficial?
Please hurry, this is for Zoology under the Mollusca section
Answer:
Nautiluses made this development through years of evolution. They developed jet propulsion to help them to better outswim predators.
Explanation:
This is my answer, not a sample answer. Hopefully, it helps! :)
Select ALL the correct answers. Based on these images, what can you say about the tentacles of an octopus and the limbs of a lizard? Group of answer choices They’re homologous structures. They’re neither homologous nor analogous structures. They’re neither vestigial nor homologous structures. They’re vestigial structures. They’re analogous structures.
Tentacles of an octopus as well limbs of a lizard are analogous structures.
Analogous structures or organs perform the same function in different organisms that bear no resemblance to each other anatomically. Analogous structures are formed as a result of convergent evolution, i.e. different structures evolving for the similar function and thus having similarity. Tentacles of an octopus as well as limbs of a lizard are used for the similar function, i.e. locomotion in this case.
On the other hand, homologous structures result from divergent evolution. Homologous organs contain a similar basic structure but perform distinct functions in different organisms.
To learn more about Homologous organs here
https://brainly.com/question/14963404
#SPJ1
which question is most closely related to the field of biology?
A.) what is the nearest planet to earth?
B.) how do you design a cheaper automobile?
C.) how many planets are there in the solar system?
D.) what is the cause of cancer in mice?
Answer:
option(D).what is the causes of cancer in mice
Answer:
The Closest question related to biology is D.) What is the cause of Cancer in mice
Explanation:
Wind has no effect on a plants respiration rate
O True
False
Question 2 (2 points)
Where sugars are formed are refered to as the sink
True
O False
Question 3 (2 points)
Both the xylem and phloem do not use any plant energy to translocate materials
O True
O False
Question 4 (2 points)
The amount of humidity in the air will affect transpiration
O True or False
Wind has no effect on a plants respiration rate True
Where sugars are formed are referred to as the sink True
Both the xylem and phloem do not use any plant energy to translocation materials True
The amount of humidity in the air will affect transpiration True
The rate of transpiration reduces as the relative humidity of the air around the plant increases. Compared to more saturated air, dryer air makes it simpler for water to evaporate. A plant's transpiration rate will rise when air movement around it increases.
What about plants respiration?Water vapor is lost via the process of transpiration through a plant's stomata. When it's very hot outside, the plant loses water vapor to cool down, and water from the stem and roots flows up or is "drawn" into the leaves. In addition, plant transpiration contributes significantly to the leaf's energy balance by providing evaporative cooling. Additionally, the movement of water and nutrients from the roots to the shoots is accelerated by transpiration. Plants use transpiration for a variety of purposes. The direct effects of transpiration include controlling the plant's temperature and supplying water for photosynthesis. Additionally, it facilitates the movement of glucose and nutrients through the plant's vascular tissues. Plants lose water through a process known as transpiration. A plant's roots can collect up to 99.5% of the water that the plant transpires, which is not used for growth or metabolism. For the surroundings to remain wet, transpiration is necessary.Learn more about plants respiration here:
https://brainly.com/question/2951421
#SPJ13
typically, how many molecules of atp (or gtp) are produced by the tca cycle from each molecule of glucose that is completely oxidized to 6 co2 molecules?
The TCA cycle typically generates 2 molecules of ATP (or GTP) from each molecule of glucose that is totally oxidized to 6 co2 molecules.
What makes something a molecule?Its original definition, "the smallest unit of a substance that yet preserves the qualities of that substance," was intended to be encompassed by this designation. An atom is a body that cannot be divided into two, and a molecule is the tiniest unit of a certain material, according to James Maxwell's definition from 1873.
Molecule is it an atom?A molecule is a cluster of two or more atoms that can be divided into smaller recognizable units while still retaining the chemical make-up and physical characteristics of a pure material.
To know more about molecule visit :
https://brainly.com/question/14362857
#SPJ4
In considering the cross YyRr x YyRr, the phenotype ratios of the F2 generation will be _____.
Answer:
f2
Explanation:
Given that propane has carbon in it, do you think that water could be the only product from the burning of propane? Why or why not?
No. Water cannot be the only product of the combustion of propane because carbon dioxide is also formed simultaneously.
Combustion of propaneGenerally, hydrocarbons undergo combustion reactions with oxygen. When this happens, complete combustion leads to the production of carbon dioxide and water. The general equation for the combustion of hydrocarbons is written as: [tex]C_nH_{2n+2} + (3n+1)/2 O_2 = n CO_2 + (n+1) H_2O[/tex]
Propane is a hydrocarbon with the chemical formula, [tex]C_3H_8[/tex]. Thus, when it burns in oxygen, the equation of the reaction becomes:[tex]C_3H_8 + 5O_2 -- > 3CO_2 + 4H_2O[/tex]
From this equation, we can see that not only water is produced when propane burns in oxygen, but carbon dioxide molecules as well. Thus, water cannot be the only product of propane combustion because another product, carbon dioxide, is also formed.
More on propane combustion can be found here:
https://brainly.com/question/3014094
#SPJ1
Question 4
Below is the CODING STRAND of a small gene that codes for a peptide. Assume the gene has a
traditional start codon.
How many amino acids long is the peptide if we assume traditional start and traditional stop
codon?
5' AATCCGTATCTATGACCGTTTGGAAACACTAAGCGGTACTC 3'
3
5
6
9
Transcription is mRNA synthesis, which occurs by complementing a segment of the DNA template strand. The translation is the protein growth, which occurs by adding amino acids coded by mRNA codons. C) the polypeptide is 6 amino acids long.
What are transcription and translation?The whole process of protein synthesis includes Transcription and translation.
TRANSCRIPTION
Transcription is the mRNA synthesis process and occurs in the nucleus.
The DNA template strand is read in direction 3'→ 5' to build the mRNA molecule in direction 5'→ 3'. The template strand is the one that is going to be complemented by the mRNA.
mRNA molecule has the same sequence as the DNA coding strand, but it carries uracil instead of thymine.
TRANSLATION
Translation is the process through which polypeptide grows. It occurs in the cytoplasm.
rRNA and tRNA read mRNA in the direction 5'→ 3' and add the correct amino acids to build the new protein.
Amino acids are coded by mRNA codons. Protein synthesis initiates in the AUG start codon -Metionin- and ends when reaching either of the stop codons UAA, UAG, or UGA.
In the exposed example, we have a DNA strand. We know that it is the coding strand, so it has the same sequence as mRNA molecule.
DNA coding strand5' AATCCGTATCTATGACCGTTTGGAAACACTAAGCGGTACTC 3'
mRNA molecule5' AAUCCGUAUCUAUGACCGUUUGGAAACACUAAGCGGUACUC 3'
Kowing mRNA sequence, we can grow the protein.
So first, we need to find the initiation codon (AUG), begining from the mRNA 5' extreme. Then we need to find a stop codon (UAA, UAG, or UGA).
mRNA start codon5' AAUCCGUAUCUAUGACCGUUUGGAAACACUAAGCGGUACUC 3'
mRNA stop codon5' AAUCCGUAUCUAUGACCGUUUGGAAACACUAAGCGGUACUC 3'
So this protein begins in AUG and ends in UAA.
To grow the protein, we need to separate mRNA codons and find the corresponding amino acids.
mRNA codons ⇒ AUG ACC GUU UGG AAA CAC UAA amino acids ⇒ Met Thr Val Trp Lys His Stop Protein ⇒ Met-Thr-Val-Trp-Lys-HisAccording to this reasoning, the polypeptide is 6 amino acids long. Option C) is correct.
You can learn more about protein synthesis at
https://brainly.com/question/16305501
#SPJ1
True or false In a single celled organism, mitosis is used for reproduction.
Answer:
the answer is true.
What is the relationshiop between the inputs and outputs of photosynthesis?
The inputs and outputs have the same number of atoms on both sides of the
equation for photosynthesis.
The more molecules that are input into photosynthesis, the more output can be
produced.
The inputs and outputs have the same type of atoms (carbon, hydrogen and
oxygen) on both sides of the equation for photosynthesis.
All of the above.
Answer:
Photosynthesis is when a plant is absorbing water, sunlight, for its energy, This means that your answer is the inputs and outputs have the same type of atoms
Answer:
If you are talking about the 5.03 Photosynthesis Gizmo Quiz, the answer is D. all of the above.
Explanation:
What tissue does a arctic fox have please ghelp
Answer: Epithelial Tissues
Patrick met Patti at the dance. Both of them are heterozygous for their pink body color, which is dominant over a yellow body color. Create a Punnett square to show the possibilities that would result if Patrick and Patti had children.List the possible genotypes and phenotypes for their children.What are the chances of a child with a pink body? ____ out of ____ or ___%What are the chances of a child with a yellow body? ___ out of ___ or ___%
If they are heterozygous and pink is dominant over yellow, this means that both Patrick and Patti have the following genotype: Pp.
Therefore, we should create a Punnet square crossing Pp x Pp, as follows:
There are one PP (homozygous dominant), two Pp (heterozygous) and one pp (homozygous recessive) in the diagram. So PP represents 1/4 (or 25%), Pp represents 2/4 (or 50%) and pp represents 1/4 (or 25%).
It is important to note that PP and Pp both will lead to a pink color, and only pp will lead to a yellow color.
Therefore:
The chances of a child with a pink body are three out of four, or 75%
The chances of a child with a yellow body are one out of four, or 25%
Fill in the blanks need explanationVolcanic eruptions has ______ and _____ effect on the environment
The volcanic eruptions has the release of volcanic gas and it provoke climate changes that has a negative effect on the environment.
Prokaryotic cells are much smaller than eukaryotic cells.
Answer:
Yes, Prokaryotic cells are much smaller than Eukaryotic Cells
Explanation:
Generally, Prokaryotic Cells are smaller as they contain less genetic material and other mechanisms to maintain that material.
what problem is faced by organisms that live in fresh water? what problem is faced by organisms that live in fresh water? without compensating mechanisms, their bodies tend to take in too much water. they will have higher concentrations of body solutes than organisms that live on land. their bodies tend to lose too much water to their environment. they have no way of controlling their tonicity.
Problems faced by organisms that live in freshwater are without compensating mechanisms, their bodies tend to take in too much water.
Their bodies have a tendency to absorb too much water since freshwater organisms' environments are hypotonic in nature to their cells, which causes the organisms' bodies to do the same. They are unable to manage their tonicity. Only saltwater causes issues for the creatures who inhabit it.
The osmotic principle states that water travels from a location of low solute concentration (hypotonic) to a region of high solute concentration (hypertonic). As a result, the low solute content in the water creates difficulty for freshwater creatures since they have a tendency to use too much water.
To learn more about Freshwater visit: https://brainly.com/question/3759176
#SPJ4
Darwin's theory of evolution supports the concept of anagenesis (gradualism) of groups (clades) of organisms vs. _
Answer:
Explanation:
Natural SelectionThe theory of natural selection was the main tenet of Darwin's biological evolutionary scheme, although other important aspects included descent, gradualism, the multiplication of species (including geographic speciation), and sexual selection. While incorporating Malthusian aspects of the multiplication of species and population checks, Darwin's insight was that the stronger members of each species would survive and the weakest would be eliminated (become extinct). These concepts formed the basis of natural selection, which was Darwin's ‘mechanism’ of evolutionary change. Darwin argued for a natural process of variation, struggle, and the selection of traits favorable for survival:Owing to this struggle for life, any variation, however slight and from whatever cause proceeding, if it be in any degree profitable to an individual of any species, in its infinitely complex relations to other organic beings and to external nature, will tend to the preservation of that individual, and will generally be inherited by its offspring. … I have called this principle, by which each slight variation, if useful, is preserved, by the term of Natural Selection, in order to mark its relation to man's power of selection (Darwin, 1859: 61).Darwin's theory of natural selection incorporated the idea that all species were linked to one another in time and space by descent. This was expressed through the metaphor of a branching tree of life, where the trunk symbolized the common ancestor from which all animals had originated. Central to this model of evolutionary development was the idea of a haphazard process of evolution, which rejected progressionist notions of linear development. This haphazard process occurred as each species became better adapted to its surrounding environment. Any environmental changes that occurred would affect the development of the species, and could cause species to diverge onto different branches of evolution, and in some cases to become extinct. The branching tree metaphor was considered early in the development of the theory of natural selection, as shown by a sketch in Darwin's Notebook B (Figure 3) and a detailed diagram was included in The Origin (Figure 4). Here the letters A–L represent parent species which resemble each other to varying degrees (thus spaced unevenly). The dotted lines diverging from each original species represent offspring from these species. Through the process of natural selection over many generations, some original species will develop new varieties and others will become extinct. New species varieties are represented at the top of the diagram (a14, q14, and so on). Darwin meticulously explained this diagram in chapter IV of The Origin, and the strength of his account is reinforced through the written description with which he concluded the chapter:
Darwin's theory of evolution supports the concept of anagenesis (gradualism) of groups (clades) of organisms vs. that of natural selection.
What is Darwin's theory of evolution?Charles Darwin's theory or Darwinism is a theory of the biological evolution of different species which are developed by the English naturalist Charles Darwin and others, stating that all of the species of organisms arise and develop through the process of natural selection of the small, inherited variations which increase the individual's ability to compete, survive, and reproduce better in the surrounding environmental conditions in which they live in.
The five major theories given by Charles Darwin include evolution of species as such, common descent, gradualism, multiplication of species, and natural selection of species.
Learn more about Darwin's theory of evolution here:
https://brainly.com/question/25718754
#SPJ2
If a trait is found to be determined by a gene found only on the x chromosome, it is considered to be.
Genetic disorders connected to mutations in genes on the X chromosome are referred to as having X-linked recessive inheritance.
What is chromosomes?Genomic information is transported from cell to cell via chromosomes, which are threadlike structures consisting of protein and a single DNA molecule. Chromosomes are found in the cell nucleus of all plants, animals, and humans.Chromosomes' primary role is to transport DNA and pass genetic material from one set of parents to another. During cell division, chromosomes are crucial. They protect the DNA against tangles and damage.Genetic problems connected to mutations in X chromosome genes are referred to as X-linked recessive inheritance. Due to the fact that he possesses just one X chromosome, a male with this mutation will be impacted. The majority of the time, a female with a gene mutation on one X chromosome and a normal gene on the other X chromosome is unaffected.To learn more about chromosomes refer to :
https://brainly.com/question/11912112
#SPJ4
Which is correct about warm currents?
A. They Make Landmasses Warmer
B. They move from the poles to the Equator
C. They are denser than cold currents
D. They are surface currents
The best description of warm current from the choices given above is that: They are surface currents.
The correct answer choice is option d.
What is meant by warm current?Warm current can simply be defined as that current which usually moves towards the poles from the equator. It is a fallacy to believe that warm current move from the poles to the Equator as described among the choices given above.
However, they are surface currents and the water inside them is usually, frequently and most of the time more warmer than the surrounding water.
In conclusion, it can be deduced from the explanation given above that warm current influence the climatic zones.
Read more on warm current:
https://brainly.com/question/16018929
#SPJ1