Answer:
Blighia Sapida (aka Ackee)
Explanation:
18. As part of an experiment, a light source is placed next to a plant. After a few days, the plant is growing toward
the light. The light acted as a(n)..
a. stimulus
b. response
c. growth
d. defense
Answer:
The answer is A, stimulus
what are the characteristic features of the arthropods? what are the advantages and disadvantages of these features
Main characteristic features of the arthropods is that their exoskeleton is made of chitin and circulatory system is open.
Characteristics:
The body is trigerminated, segmented, and bilaterally symmetrical.They show the tissue level of the organ system.The body is divided into head, thorax and abdomen.Their bodies have articulated appendages that help them move.The body cavity is filled with blood.Terrestrial arthropods secrete from the malpighian tubules, whereas aquatic arthropods secrete from green or coaxial glands.They are unisexual and fertilization is either external or internal.They have a well-developed digestive system.Breathe through the general body surface or trachea.Advantage:
Arthropods are layers of wax that prevent dehydration and prevent the body from drying out
Disadvantage:
The exoskeleton cannot grow. As the animal grows, it must molt or molt the exoskeleton and wait for the underlying new exoskeleton to harden.
Learn more about arthropods from:
https://brainly.com/question/2244172
#SPJ4
compare the wave shape of an alligator’s low-frequency mating call with the wave shape of a frog’s high-frequency chorus. How are the shapes different
The comparison of the wave shape of an alligator’s low-frequency mating call with the wave shape of a frog’s high-frequency chorus in the way that their shapes are different is that The high-frequency shapes are relatively close together whereas the low-frequency waves are spaced out.
What is the mating call about?American alligators aren't afraid to make their presence known when they're looking for a mate, and the outcome might sound like a cross between a motorcycle and the loudest snorer ever. An image of a huge male making one of its loud grunting mating sounds is captured on camera.
So, Odorrana tormota and Huia cavitympanum are two species of frogs that are currently recognized for their ability to vocalize at high frequencies, or even partially ultrasonically. Both individuals' hearing systems have been specially modified so they can hear in the high-frequency band.
Therefore, While the high-frequency patterns are closely spaced apart, the low-frequency waves are elongated in both animals.
Learn more about low-frequency from
https://brainly.com/question/21890312
#SPJ1
how does the cell membrane work
Answer:
The cell membrane, also called the plasma membrane, is found in all cells and separates the interior of the cell from the outside environment. The cell membrane consists of a lipid bilayer that is semipermeable. The cell membrane regulates the transport of materials entering and exiting the cell.
Explanation:
typically, how many molecules of atp (or gtp) are produced by the tca cycle from each molecule of glucose that is completely oxidized to 6 co2 molecules?
The TCA cycle typically generates 2 molecules of ATP (or GTP) from each molecule of glucose that is totally oxidized to 6 co2 molecules.
What makes something a molecule?Its original definition, "the smallest unit of a substance that yet preserves the qualities of that substance," was intended to be encompassed by this designation. An atom is a body that cannot be divided into two, and a molecule is the tiniest unit of a certain material, according to James Maxwell's definition from 1873.
Molecule is it an atom?A molecule is a cluster of two or more atoms that can be divided into smaller recognizable units while still retaining the chemical make-up and physical characteristics of a pure material.
To know more about molecule visit :
https://brainly.com/question/14362857
#SPJ4
How did Nautiluses developed jet propulsion. Why was it envolutionarily beneficial?
Please hurry, this is for Zoology under the Mollusca section
Answer:
Nautiluses made this development through years of evolution. They developed jet propulsion to help them to better outswim predators.
Explanation:
This is my answer, not a sample answer. Hopefully, it helps! :)
all fuels are sources of energy
Answer:
they are usually considered to be a primary energy source.
Explanation:
during gene expression, when dna is being transcribed into rna, the non-coding sections are removed. the remaining coding segments are connected. this process is called
As DNA is being translated into RNA during gene expression, the non-coding regions are cut out by a procedure known as RNA splicing.
What does place when DNA gets translated into RNA?In the nucleus, transcription occurs. It constructs an RNA molecule from a template made of DNA. Translation takes place when RNA travels from the nucleus to a ribosome in the cytoplasm. A protein is created during translation by reading the genetic code in mRNA.
What happens when you're transcribing?The information contained in a gene's DNA is transferred to RNA (ribonucleic acid), a molecule comparable to DNA, in the cell nucleus during transcription. Both RNA and DNA are composed of a series of units known as nucleotides.
To know more about rna visit:-
https://brainly.com/question/20914096
#SPJ4
Yeast is a unicellular organism that undergoes fermentation, a type of anaerobic respiration, to convert sugar into alcohol and carbon dioxide. In an experiment testing yeast activity, Sakurapoured equal amounts of warm water into two bowls. She added 1 teaspoon of sugar to only one bowl. Next, she added 1 teaspoon of yeast to each bowl. Within a few minutes, bubblesstarted to rise to the top of both bowls. Which of the following best explains why Sakura observed more bubbles produced in the bowl with sugar than in the bowl without sugar?A.Sugar provided the chemical energy for driving photosynthesis, resulting in greater production of oxygen bubbles.B.Sugar provided the light energy for driving cellular respiration, resulting in greater production of oxygen bubbles.C.Sugar provided the light energy for driving photosynthesis, resulting in greater production of carbon diaxide bubbles.D.Sugar provided the chemical energy for driving cellular respiration, resulting in greater production of carbon dioxide bubbles.
The correct answer is D. Sugar provided the chemical energy for driving cellular respiration, resulting in greater production of carbon dioxide bubbles. Sugar is a chemical used by heterotrophic organisms to perform cellular respiration, which ultimate product is carbon dioxide (CO2).
two (2) ways in which octopuses are considered one of the most intelligent animals that exist in our world today.
Some ways in which octopuses have shown their intelligence in labs has been by completing various maze and opening tricky traps to acquire food rewards.
Octopuses are deep sea creatures who are well known for their 8 suction cups lined limbs along with their bulbous head and ink-secreting mechanism.
Of all the invertebrates octopuses are considered to be the most intelligent creatures.
They have a complex system of neurons that together act as a brain. This allows the octopus to perform various tasks such as touching animals and manipulating its surroundings or smell.
Apart from this all of the octopus's 8 arms can be moved independently from each other.
Some ways in which octopuses have shown their intelligence in labs has been by completing various maze and opening tricky traps to acquire food rewards.
Learn more about octopuses at:
brainly.com/question/26814725
A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write the mRNA that would be transcribed from this DNA fragment.b) Circle the starter and the stopper in your mRNA sequence. Write the sequence of amino acids which would be encoded in translation. Use the mRNA codon table provided.c) Where in the cell do transcription and translation occur?
a) In order to transcribe the segment of DNA, it is important to note that this process is important for gene expression as a protein. An enzyme called RNA polymerase moves along the DNA until the end of the gene, releasing the mRNA. The DNA has two strands: one that goes from 5' to 3' direction, and another one that goes from 3' to 5' direction. The one that's used for transcription will always be the 3' to 5' one, so we already have the correct strand to work with, as it is a 3' to 5' strand.
However, the mRNA will be assembled in the 5' to 3' direction. Using the same complementary base-pairing rules as in DNA, we will pair Cytosine (C) with Guanine (G), but as there is no Thymine (T) in RNA, we will pair Adenine (A) with Uracil (U).
Therefore, the sequence o mRNA read in the 5' to 3' direction is:
5' CUAUGGAAACACAUCAGUAGAA 3'
b) The starter codon is the AUG codon of a messenger RNA (mRNA). Therefore, the sequence of amino acids will start to be decoded there.
The stopper codon can be one of the three following options: UAA, UAG or UGA. In this case, we can only find the UAG codon.
The codons, then will be:
AUG GAA ACA CAU CAG UAG
Then, we can say that the amino acids translated will be:
Met Glu Thr His Gln
(Methionine - Glutamine - Threonine - Histidine - Glutamine
c) In eukaryotes, transcription occurs inside the nucleus of the cell and translation occurs in the cytoplasm.
List 3 other species that would be in the same trophic level as the warthog
A lion, a crocodile, and a wild dog.
you have identified a receptor in a pathway that you are studying. the next relay protein in the pathway is phosphorylated on a tyrosine to activate it. how can you determine if the receptor is a rtk or a tk-associated receptor?
Typically, the receptor kinase protein has a transmembrane domain. The non-receptor tyrosine kinase, though, lacks a transmembrane domain.
What distinguishes receptor tyrosine kinases from G protein-coupled receptors?The main distinction between receptor tyrosine kinases and G protein coupled receptors is that the former can only cause one cell response from a single ligand binding, whereas the latter can cause multiple cell responses from a single ligand binding.
A RTK, is HER2?As a transmembrane RTK, HER2 is activated upon dimerization with another receptor from the epidermal growth factor family, such as EGFR (ERBB1), ERBB3 (HER3), and ERBB4 (HER4).
To know more about receptor visit:-https://brainly.com/question/29343237
#SPJ4
5 functions of mesophyte
Answer: Find your 5
Explanation:
Mesophytes generally require a more or less continuous water supply. They usually have larger, thinner leaves compared to xerophytes, sometimes with a greater number of stomata on the undersides of leaves. Because of their lack of particular xeromorphic adaptations, when they are exposed to extreme conditions they lose water rapidly, and are not tolerant of drought. Mesophytes are intermediate in water use and needs. These plants are found in average conditions of temperature and moisture and grow in soil that has no water logging. The roots of mesophytes are well developed, branched and provided with a root cap. The shoot system is well organised. The stem is generally aerial, branched, straight, thick and hard. Leaves are thin, broad in middle, dark green and of variable shape and measurement.[citation needed]For example, in hot weather they may overheat and suffer from temperature stress. They have no specific adaptations to overcome this, but, if there is enough water in the soil to allow this, they can increase their rate of transpiration by opening their stomata, thus meaning some heat is removed by the evaporating water. However these plants can only tolerate saturated soil for a certain amount of time without a warm temperature. In dry weather they may suffer from water stress (losing more water via transpiration than can be gained from the soil). Again they have no specific adaptations to overcome this, and can only respond by closing their stomata to prevent further transpiration. This does actually have some benefits as it reduces the surface area of the leaves exposed to the atmosphere, which reduces transpiration. Prolonged periods of dehydration, however, can lead to permanent wilting, cell plasmolysis, and subsequent death. Since mesophytes prefer moist, well drained soils, most crops are mesophytes. Some examples are corn (maize), cucurbits, privet, lilac, goldenrod, clover, and oxeye daisy
Which molecule is most common in the human body?
A. H₂
B. N₂
C. H₂0
D. CO₂
Answer:
c) H₂0
Explanation:
H₂0 molecule (water) is the most common molecule in the human body. Hence, option (c) is the correct answer.
How has the carbon cycle changed between the Pre-Industrial and Post-Industrial eras?
Answer: It converts corbon to dox
Explanation:
Volume can be measured in liters or cubic meters.
Please select the best answer from the choices provided
OT
OF
Answer:
The correct answer option is True.
Explanation:
Volume can be measured in liters or cubic meters - it is true.
The measure of the amount of space which an object or a substance can occupy is said to be its volume.
The basic unit of volume in the metric system is a liter while the SI unit of the volume is the cubic meter.
Therefore, the given statement is true.
which experimental results would demonstrate that central pattern generators are involved in producing the muscle contractions involved in rhythmic movement?
The experimental result that displayed the central pattern generators' involvement in muscle contractions is that 'an insect in which the sensory afferents from the wings have been cut can fly', which suggests that option C is the right answer.
Central pattern generators are neuronal circuits which when activated produce rhythmic motor patterns such as walking, breathing or flying etc. in the absence of sensory signals. Muscle contraction refers to the activities such as tightening, shortening, or lengthening of muscles when some activity is performed by the body. It is caused due to the information signal received by the brain and then returned back to site of stimuli. The experiments conducted displayed that a deafferented locust could generate rhythmic flight motor patterns in response to non-rhythmic stimulation of the nerve cord.
Learn more about Central pattern generators at:
brainly.com/question/15565886
#SPJ4
To refer to complete question, see below:
Which experimental results would demonstrate that central pattern generators are involved in producing the muscle contractions involved in rhythmic movement?
a. A cat whose cerebral cortex has been removed can walk and run on a treadmill.
b. A cat whose cerebral cortex has been removed has impaired balance on a treadmill.
c. An insect in which the sensory afferents from the wings have been cut can fly.
d. An insect in which the sensory afferents from the wings have been cut has an unusually slow wingbeat frequency.
Given that propane has carbon in it, do you think that water could be the only product from the burning of propane? Why or why not?
No. Water cannot be the only product of the combustion of propane because carbon dioxide is also formed simultaneously.
Combustion of propaneGenerally, hydrocarbons undergo combustion reactions with oxygen. When this happens, complete combustion leads to the production of carbon dioxide and water. The general equation for the combustion of hydrocarbons is written as: [tex]C_nH_{2n+2} + (3n+1)/2 O_2 = n CO_2 + (n+1) H_2O[/tex]
Propane is a hydrocarbon with the chemical formula, [tex]C_3H_8[/tex]. Thus, when it burns in oxygen, the equation of the reaction becomes:[tex]C_3H_8 + 5O_2 -- > 3CO_2 + 4H_2O[/tex]
From this equation, we can see that not only water is produced when propane burns in oxygen, but carbon dioxide molecules as well. Thus, water cannot be the only product of propane combustion because another product, carbon dioxide, is also formed.
More on propane combustion can be found here:
https://brainly.com/question/3014094
#SPJ1
Define polar molecule or polarity.This is not a test question, could you please simplify the response to as few sentences as possible?
Polarity is caused by electronegativity. Electronegativity is the ability of an atom to attract electrons and when in a molecule there is a region of low electronegativity and a region of high electronegativity we say that the molecule is polar.
Sensing systems incorporated into harvesting machines that register and record amounts of harvests associated with specific portions of a planted field are called monitoring systems.
Crop monitoring makes use of space-based data to keep tabs on crop development and forecast crop yields for certain fields that have been planted.
What is monitoring systems?A system for monitoring agriculture consists of a network with wireless sensors. These sensors gather information from several nodes positioned on the playing surface. Then, specialists or nearby farmers analyze this data. The data can be used to make a number of inferences about weather patterns, soil fertility, crop quality, etc. A system is developed for agricultural field monitoring in IoT-based modern agriculture with the aid of sensor like light, humid, temperatures, soil moisture, etc. Farmers may monitor the condition of thier fields from any location. IoT-based smart farming is considerably more efficient than conventional farming.
How do farmers monitor their crops?Nowadays, satellite techniques are widely employed in agriculture, and many farmers use them frequently to observe their fields and assess the condition of their crops. Crop monitoring is crucial for managing various pests, weeds, and diseases that affect crops. This gives information about the crop's current situation, and you can then look ahead in time to forecast what will probably be the crop's next problem.
To know more about Monitoring Systems visit:
https://brainly.com/question/28776835
#SPJ1
What factor determines when an animal species will enter an ecosystem insuccession?A. Food availabilityB. PioneersC. CompetitionD. Minerals
Ecology: Ecological succession
Ecological succession is the process of change in the species present in an ecosystem over time.
There are two types of succession:
• Primary succession,, where an area that hasn't had any life before begins to be colonized, such as a new island.
,• Secondary succession,, where there is a disturbance, such as a fire, that removes the organisms living in that area.
The changes in plants depend on changes in the soil and interactions with other organisms, such as competition for light with other plants and feeding from herbivores.
On the other hand, the changes in animals depend on sources of food and predation interactions.
This means the correct answer would be A. Food availability.
what does atg in the liam/elijah coding sequence of dna correspond to in the mrna and resulting amino acid chain? what does tac in the leah/jenny template sequence of dna correspond to in the mrna and resulting amino acid chain?
The atg in the liam/elijah coding sequence of DNA correspond to in the mrna and results into Elijah: UAU, UCU, CAA, CCC, GAU and liam: UGU,UCA, UAA, CCU, GAG.
What is coding sequence and amino acid chain and what does tac in the template sequence correspond to?Coding sequence is a sequence of DNA which codes for a particular character and even this is sequence which proceed further in the generation.There are non coding sequences also which are excised later in the process by removal enzymes and the coding sequences are proceeded further for the process.Here the question is asked of the atg in the liam/elijah who are brothers and the coding sequence of DNA correspond to in mRNA and resulting amino acid chain too and the tac in the DNA template too.Well the resulting amino acid chain in would be Elijah: UAU-UCU-CAA-CCC-GAU and the amino acid sequence in Liam would be UGU-UCA-UAA-CCU-GAG.Hence the amino acid sequence in the two brothers are so as mentioned in the point above and the amino acid sequence is initial progenitor for the mRNA processing.To know more about mRNA visit:
https://brainly.com/question/12903143
#SPJ4
6. Analyze How can the introduction of nutria affect a pond ecosystem food web?
The introduction of nutria affects a pond ecosystem food web because the saltwater marshes are destroyed by Nutria's ravenous eating habits.
Nutria's ravenous appetite for food causes the destruction of saltwater marshes, which reduces the amount of food and shelter available to other species and promotes severe erosion.
By devouring the wetland grasses, Nutria devastates the area's food chain and environment. A few invasive species seriously hurt the economy. The amount of above- and below-ground plant matter that nutria consume daily can reach up to 25% of their body weight.
Nutria obliterates the banks of ditches, lakes, and other bodies of water in addition to harming vegetation and agriculture. What's most important, though, is the long-term harm that nutria may do to wetlands like marshes.
To learn more about Nutria visit: https://brainly.com/question/17690670
#SPJ9
Need some help figuring out the basis of this
Demonstrate your understanding of marine plankton, microbes, plants, and algae by creating two job postings or resumes. These should include how those organisms are important to their ecosystems. See the assignment details for further instructions.
In the experiment described in the animation, why did the investigators add a mutagen to the culture medium?.
In the experiment described in the tutorial, the investigators add a mutagen to the culture medium to increase the rate of evolutionary change in the viruses.
What is mutagen?Any factor that results in a mutation (a change in the DNA of a cell). Mutagens can injure cells and cause some diseases, like cancer, by altering DNA. Radioactive elements, x-rays, ultraviolet rays, and certain compounds are examples of mutagens.
What is a virus?A virus is an infectious microorganism made up of a protein-coated segment of nucleic acid (either DNA or RNA). A virus can't multiply by itself; it has to infect cells in order to utilize the host cell's components to make copies of itself. Viruses are composed of bundles of DNA or RNA that are encased in a protein capsule called a capsid. Infectious agents that are acellular and must exist in the presence of a host cell in order to grow, viruses are frequently referred to as obligatory intracellular parasites. All cell types, including those in people, animals, plants, bacteria, yeast, archaea, and protozoa, have been proven to be susceptible to certain viruses.
Thus from above conclusion we can say that in the experiment described in the tutorial, the investigators add a mutagen to the culture medium to increase the rate of evolutionary change in the viruses.
Learn more about the virus here:
https://brainly.com/question/25236237
#SPJ1
What are the 2 types of cells????
Answer:
The two types of cells are prokaryotic and eukaryotic.
Answer:
Prokaryote and Eukaryote Cells
Explanation:
What is a Prokaryote Cell?A prokaryote cell is a cell which has no nucleus or membrane-bound organelles.
What is an Eukaryote Cell?A Eukaryote cell is a cell which has a nucleus and membrane-bound nucleus.
What's a chart to help you identity cells.Scientist use a dichotomous key to determine scientific names of things and it helps determine which cell is which.
To learn more about Prokaryote and Eukaryote Cells visit
https://brainly.com/question/6871687
To learn more about dichotomous keys visit
https://brainly.com/question/16333970?referrer=searchResults
Given that propane has hydrogen in it, do you think that carbon dioxide could be the only product from the burning of propane? Why or why not?
No. Carbon dioxide cannot be the only product of the burning of propane. Water is also produced.
Combustion of hydrocarbonsGenerally, hydrocarbons undergo combustion reactions with oxygen. When this happens, complete combustion leads to the production of carbon dioxide and water.
The general equation for the combustion of hydrocarbons is written as: [tex]C_nH_{2n+2} + (3n+1)/2 O_2 = n CO_2 + (n+1) H_2O[/tex]
Propane is a hydrocarbon with the chemical formula, [tex]C_3H_8[/tex]. Thus, when it burns in oxygen, the equation of the reaction becomes:
[tex]C_3H_8 + 5O_2 -- > 3CO_2 + 4H_2O[/tex]
From this equation, we can see that not only carbon dioxide is produced when propane burns in oxygen, but water molecules as well.
Thus, carbon dioxide cannot be the only product of propane combustion because another product, water, is also formed.
More on propane combustion can be found here: https://brainly.com/question/3014094
#SPJ1
Match the terms regarding the subhylum Vertebrata to their correct phase of definition.
• Axial Skeleton,: A division of the skeleton consisting of the skull, thoraz and vertebral column
,• Appendicular Skeleton,: A division of the skeleton composed of the girdle and limb bones
,• Oviparous,: These organisms lay eggs that develop and hatch outside the mother.
,• Viviporous,: These organisms nourish their offspring inside the mother during development and give birth to live young.
,• Ovoviviparous,: These organisms carry their young in eggs inside the mother, when the eggs hatch, the mother gives birth to live young.
which one could produce a sperm with two x chromosomes: nondisjunction during meiosis 1 or nondisjunction during meiosis 2?
Nondisjunction during meiosis 2 could produce a sperm with two x chromosomes.
Nondisjunction can occur during meiosis I and meiosis II, resulting in an abnormal gamete chromosome number. The main difference between meiosis 1 and meiosis 2 nondisjunction is that meiosis 1 does not separate homologous chromosomes, whereas meiosis II does not separate sister chromatids.
Nondisjunction means that the pair of homologous chromosomes did not separate or did not separate at anaphase so that both chromosomes of the pair end up in the same daughter cell. This probably occurs most frequently in meiosis, but can occur in mitosis to create mosaic individuals.
Meiotic nondisjunction can result in pregnancy loss or the birth of children with extra chromosomes in every cell, whereas mitotic nondisjunction results in mosaicism of two or more cell lineages. Aneuploidy can also result from late delay.
Learn more about meiosis from:
https://brainly.com/question/29383386
#SPJ4