Answer: It's D aka Special fibers that relay electrical impulses to the ventricles, which cause contraction.
Explanation:
what does it mean to say that CO2 becomes "fixed" during photosynthesis
Answer:
What does it mean to say that CO2 becomes "fixed" in talking about photosynthesis?
A. CO2 becomes bonded to an organic compound.
Explanation:
What do you observe about the structure
of the white blood cell? How do you think
this is related to its function of trapping
pathogens in the body?
Please help I’ll give brainlyiest
Answer:
White blood cells engulf and digest pathogens and any other unknown material in the blood and tissues. They engulf the pathogen into a vesicle called a phagosome. This fuses with a lysosome and the enzymes break down the pathogen.
White blood cells foremostly recognize any pathogen or foreign substance in the body and then engulf it with the help of receptors like Toll-like receptors. Finally, the killing of antigen takes place by phagocytosis.
What do you mean by Pathogens?Pathogens may be defined as any microorganisms which are capable of inducing diseases in other living organisms.
After engulfing, the antigen is packed under a vesicle known as a phagosome. This phagosome is then treated with lysosomes to form a structure known as phagolysosomes.
Thes phagolysosomes are responsible for the breakdown of antigen, which is then presented by MHC molecules to perform perforin-granzyme mediated killing of antigen.
Therefore, it is well described above.
To learn more about White blood cells, refer to the link:
https://brainly.com/question/9332702
#SPJ2
Which cell structure serves the stated function in both eukaryotic and prokaryotic cells?
nucleus: stores genetic material
O cytoplasm: protects cell structures
O ribosomes: regulate cell processes
O DNA: surrounds cell contents
Answer: O cytoplasm: protects cell structures
Explanation:
By which process do plants try to avoid
self-pollination?
A. The plant dies to avoid this.
B. The plant detaches the male part of the plant from
itself.
C. They attract pollinators.
D. They have no control over this process of self-
pollination.
Answer:
it's C. They attract pollinators
in drosophila melanogaster, the common fruit fly, curved wings "I" and purple eyes "r" are two linked recessive genes found on chromosomes 2. The dominant wild type alleles for those genes are long wings"L" and red eyes "R"
a)describe the expected ratio of offspring in the f2 generation of these genes were located on different chromosomes
b)the results in the f2 generation of these flies were: 40 long winged, red eyes; 40 curved winged, red eyes; 10 long winged, purple eyes, and 10 curved winged, red eyed. how many map units apart are the genes for curved wings and purple eye color?
Answer:
the other person is right, he had messed up before saying that 60 x 40 = 100, but 60 + 40 = 100. Then I had told him that his answer was wrong and that he should put the answer as 240 instead since 60 x 40 = 240 and not 100.
Explanation:
The expected ratio of offspring in the f2 generation of these genes were located on different chromosomes is 25%
What are chromosomes?A chromosome is a long DNA molecule with part or all of the genetic material of an organism. In most chromosomes the very long thin DNA fibers are coated with packaging proteins; in eukaryotic cells the most important of these proteins are the histones.
Chromosomes allow DNA to be accurately copied during these cell divisions. So one more time. Chromosomes are found in the nuclei of our cells and allow DNA to be accurately copied during cell division.
Chromosomes are thread-like structures located inside the nucleus of animal and plant cells. Each chromosome is made of protein and a single molecule of deoxyribonucleic acid (DNA).
Learn more about chromosomes:
https://brainly.com/question/21297190
#SPJ2
9.
Strand A would normally be found in the
A. plasma membrane
B. ribosome.
Yasuole
nucleus
Answer:
the Nucleus
Explanation:
Demonstrate how 200 different cells came from a single fertilized ovum ?
Answer:
Humans are not that different from other animals, but vary in the finer detail.
Indeed most amniotes (terrestrial organisms with fetuses surrounded by membrane) work pretty well along the same principles, and there’s also much in common as far back as you want to go, really, on land or in water.
And my next semi-random thought is to say that cellular differentiation, like real estate (apparently), is all about location, location, location. Where the cells are, or where they came from, seems to matter a lot.
Actually, it’s more about layers. Like an onion. Or a cake. (I can’t believe I’m writing this, and apologies to any Shrek fans out there.)
What I mean to say is that some understanding of developmental embryology will help here. To simplify things enormously, our adult cell types ultimately arise from embryonic stem cells. These stem cells are multi-purpose and programmable, or pluripotent in a sense, and capable of making whatever type or form of cell is requested. They just need to be “told” what to do. And just tiny bits of code do exactly that, flipping switches on or off as required, based on cues like orientation, chemical gradients, and proximity.
Now a quick read of the links above will explain it all, but I’ll press on anyway. Out of that initial programming arises our ‘germ layers’, the mesoderm, the ectoderm and the endoderm. We are, after all, triploblastic. 3 layers, get it?
But you knew that.
In case you didn’t, these layers in effect give you a scaffold or more accurately perhaps a tube comprising an inside, outside, and a middle. Where your cells are hanging out in that tube matters, in that they pick up on their location and auto-magically become functionally relevant to that space. In a sense, I mean. Refer back to location, location, location.
Just knowing that pattern of proximity, gradients, and orientation more than simply sets the scene. Whether you work forwards or backwards from there, you will hopefully see that these “germ layers” derive quite simply from a much earlier differentiation, and then complexify. In that sense you have your answer - a complex set of diverse cell types arises by differentiation from an earlier, simpler differentiation. Which sounds a bit clunky when I write it out, but it gives a general idea.
So how does this complicated process happen?
Well, as I mentioned chemical gradients are probably to blame here. And it actually starts before fertilisation, in that the egg itself is already semi-structured and bathed in chemicals with a high-low gradient of some sort. In that sense it’s giving cellular differentiation a head start (there’s a pun there), by setting up some sort of polarity from the beginning. At the very least we get some ends happening, or a top and a bottom if you like.
Now, again simplifying things enormously, your average fertilised egg, or zygote, has by definition a complete set of your DNA ready and waiting, which contains the code for every protein-making gene, plus transcription factors, plus whatever else gets copied for various reasons, including those we haven’t teased out as yet.
Note that those transcription factors really matter. We may have around 20,000 protein-expressing genes, but we also have some 1,500 transcription factors that seem to switch the genes on, off, or arguably and effectively somewhere in between. Well, they work in combination and by that we get a huge amount of variation in expression, and thus our cellular diversity as well.
And all of that DNA goodness is sitting in that zygote, bathed in chemicals that may vary very slightly from top to bottom and side to side as it were, by concentration and by other traits, like temperature. Several such things interact, including orientation and proximity to neighbours, but let’s assert (based on experiments) that the gradient is important, and that it continues to guide the “differentiation” process as new cells are born.
Which is to say that by this process of reading the DNA and expressing only the genes that are switched on by the helpful and gradient-sensitive (say) transcription factors, we get set up to form those 3-D axes and the scaffolding that will guide our cellular replication strategy. Which then produces a result that with each round of replication becomes subtly different and more diverse. Over time the subtlety gives way to more recognisable layers and specialisation in function.
Perhaps not the neatest, clearest explanation but the quickest and least baffling one I can come up with right now. As always, read the links to get a better grasp.
Answer:
During the development of an organism, cells differentiate into many distinct cell types. How does a single fertilized egg cell develop into so many different types of specialized cells? ... They both cannot produce all cells. Multipotent- limited to replacing cells in the tissue where they are found.
40 BRAINLEY
FFFFFFFFFFFFFFFFFFF
In normal cells the amino acid phenylalanine attaches to tRNAs with the anticodon AAA. The enzyme aminoacyl-tRNA synthetase catalyzes the reaction that attaches the amino acid to the correct tRNA. Assume that a mutation occurs in the aminoacyl-tRNA synthetase enzyme and causes it to attach lysine instead of phenylalanine to tRNAs with the anticodon AAA. What will be the consequence of this mutation for the translation process
Answer:
Aminoacyl-tRNA bond is hydrolyzed.
Explanation:
The consequence of this mutation for the translation process is the hydrolysis of aminoacyl tRNA bond occur. If the incorrect amino acid is attached to other molecule as a result of this reaction, the aminoacyl-tRNA bond is hydrolyzed. This incorrect binding of amino acid occur because of mutation in the aminoacyl-tRNA synthetase enzyme that leads to its hydrolysis.
11. Fossil fuels are considered nonrenewable resources because of -
a. Where they come from
b. How they are produced
c. How useful they are
d. How long they take to
3. Calculate the kinetic energy of a paper clip shot from a slingshot. The paper clip's mass is 0.01 kg, and its velocity is 10 m/s.
a) 0.1 J
b) 0.25 J
c) 0.5 J
d) 1 J
Answer:
C
Explanation:
0.01kg*(10m/s)^2/2=0.5
A ______ is a type of turbine used to capture the energy of moving air. A. geotherm B. windmill C. solar panel D. dam
Answer:
b windmill
Explanation:
A windmill is a type of turbine used to capture the energy of moving air.
Windmills have been used for centuries to power grain mills, water pumps, and other mechanical devices. In modern times, wind turbines are often used to generate electricity on a large scale.
Wind turbines typically consist of a rotor with two or three blades that spin around a horizontal or vertical axis. As the wind blows, it pushes the blades, causing them to rotate and give energy. The rotating blades turn a shaft, which is connected to a generator that produces electricity.
Wind turbines can range in size from small turbines used to power individual homes or businesses to large utility-scale turbines used to generate energy for the grid.
Learn more about turbines at:
https://brainly.com/question/928271
#SPJ7
Which RNA molecule is matched with its correct function?
Answer:
Which class of RNA is correctly paired with its function? Transfer RNA (tRNA): attaches to an amino acid. What is the difference between the template strand and the nontemplate strand? The template strand is the DNA strand that is transcribed into an RNA molecule, whereas the nontemplate strand is not transcribed
List the four powers of the president
Answer: The Constitution explicitly assigns the president the power to sign or veto legislation, command the armed forces, ask for the written opinion of their Cabinet, convene or adjourn Congress, grant reprieves and pardons, and receive ambassadors.
Explanation:
Helppppppppppppppppp
(iv) Measles. Mumps, Diphtheria Polio odd one
Answer: The odd one one is diphtheria
Explanation:
There are very minute living organisms that are able to cause different diseases to human which are found in our environment. These are known are microorganisms. They include:
--> viruses
--> bacteria
--> fungi
These microorganisms are able to establish an INFECTION in its human host when it's able fight and overcome the body defence mechanism of the host.
Diphtheria is the odd one because it's an infection which is caused by BACTERIA organism while other options while includes measles, mumps and polio are caused by VIRUS microorganisms.
BACTERIA are the larger microorganisms with a very simple cell structure where the nucleus is not enclosed within a membrane. While VIRUS are the simplest and smallest microorganisms which do not have a cell structure.
Diphtheria is an infection caused by the bacteria microorganism known as the Corynebacterium diphtheriae. These bacteria are able to produce toxins which is its virulent factor that are poisonous to its host.
Measles is an infection caused by paramyxovirus.
Mumps is an infection caused by mumps virus
Polio is an infection caused by picornavirus.
Therefore, Diphtheria infection is the odd one out.
12. Which of the methods of generating electricity does NOT use alternative energy
resources?
a. Burning coal in a power plant
b. Turbines spinning in dam
c. Solar panels taking in light energy
d. Drilling wells to reach hot rocks deep inside the earth
Answer:
i think its A. burning coal in a power plant
Explanation:
sorry if im wrong but please let me know if this is correct or not
The method of generating electricity that does not use alternative energy resources is burning coal in a power plant.
What are alternative energy resources?Alternative energy resources are eco-friendly resources that can be used to produce energy.
These are renewable resources and can not be extinct.
These resources do not pollute the earth.
Examples are windmills, solar panels, hydropower, etc.
Thus, the correct option is a. Burn coal in a power plant.
Learn more about energy resources
https://brainly.com/question/11193460
Assume that one backbone of a DNA molecule has the sequence given below. A-T-G-G-G-G-G-C-G-A-T-A-T-T-T-T-A-T-C-C-G-A-C-G For this sequence: give the expected sequence of the other DNA backbone. T-A-C-C-C-C-C-G-C-T-A-T-A-A-A-A-T-A-G-G-C-T-G-C give the RNA sequence transcribed from the original DNA backbone. U-A-C-C-C-C-C-G-C-U-A-T-A-A-A-A-U-A-G-G-C-U-G-C give the Amino Acid sequence of the protein built from the original DNA backbone.
Answer:
DNA: ATGGGGGCGATATTTTATCCGACG
RNA: AUGGGGGCGAUAUUUUAUCCGACG
Protein: MGAIFYPT
Explanation:
Transcription is a genetic process by which the information in a strand of DNA is copied into RNA, typically a messenger RNA (mRNA) sequence which is subsequently used to create a protein by the process of translation. During translation, each triplet of nucleotides or 'codon' corresponds to a specific amino acid. For example, AUG is a codon that codes for methionine (M) and also acts as an initiation codon at the beginning of the nascent polypeptide chain.
The average molecular weight of proteins encoded in the human genome is about 50,000. A few proteins are very much larger than this average. For example, the protein called titin, which is made by muscle cells, has a molecular weight of 3,000,000. Estimate how long it will take a muscle cell to translate an mRNA coding for an average protein and one coding for titin. The average molecular mass of amino acids is about 110 daltons. Assume that the translation rate is two amino acids per second.
Answer:
13,636 seconds = 227.3 minutes = 3.79 hours
Explanation:
The titin protein has a molecular weight of 3,000,000 daltons, while the average molecular mass of one amino acid is 110 daltons, so it is expected that this protein is composed of 27,273 amino acids (3,000,000 daltons/110 daltons = 27,272.72). Moreover, and since the translation rate is two amino acids per sec, it is expected that the protein will be synthesized in approximately 3.79 hours (27,272.72/2 = 13,636 seconds = 227.3 minutes = 3.79 hours).
Using the information in this photo, what can MOST LIKELY be learned about the rocks in the illustration?
A)
relative age
B)
absolute age
C)
melting point
D)
average rainfall
Answer:a
Explanation: got it right on usates
What genome rule does any prokaryotic life on earth commonly does not have?
a. small circular plasmid DNA
b. follows the central dogma DNA>RNA>proteins
c. has thymine in place of uracil on the RNA strand
The diagram below shows a ciliated cell from the lining of the airway.
Which of the following states its function?Required to answer. Single choice.
(1 Point)
A)it is the place where diffusion of gases take place
B)it moves mucus and sweeps dust from lungs
C)it secretes trypsin
Pls tell meeee quickkk
Answer:
the answer is a. any ciliated cell in lungs catches bacteria & debris from lungs causing cough, difficulty breathing, etc.
can develop into asthma, infection of pleura, and bronchitis...
Please Help!!!!
Muscles intended for large, powerful contractions contain llx muscle fibers. true or false
Answer:
True
Explanation:
Been learning and know
how does the process of translation convert information from a dna code to an rna code?
a. from a DNA code to an RNA code
b. from an amino acids code to a nucleic acid code
c. from an RNA code to a DNA code
d. from a nucleic acid code to an amino acid code
Answer:B
Explanation:
The nitrogen bases in DNA code for the sequence of amino acids that make up a protein
Answer:
its B
Explanation:
Cell X
Cell w
Cell Y
Cell Z
Х
х
х
Cell Membrane
x x
х
х
Cell Wall
Chloroplasts
Х
х
DNA
х
х
х
Nucleus
Х
Х
х
Which cell that was viewed is most likely a prokaryote?
nucleus,cell membrane
Which of the following is most likely true of a protein that cotransports glucose and sodium ions into the intestinal cells of an animal?
A) Sodium and glucose bind to the same site on the cotransporter.
B) Transport of glucose against its concentration gradient provides energy for uptake of sodium ions against the electrochemical gradient.
C) Sodium ions can be transported whether or not glucose is present outside the cell, but glucose transport requires cotransport of sodium ions.
D) Transport of sodium ions down their electrochemical gradient facilitates the transport of glucose against its concentration gradient.
E) Following transport of sodium ions into the cell, the cotransporter can also transport potassium ions out of the cell.
Answer:
D) Transport of sodium ions down their electrochemical gradient facilitates the transport of glucose against its concentration gradient.
Explanation:
Active transport refers to the movement of molecules across biological membranes against a concentration gradient. Active transport can be divided into 1-primary active transport, which requires energy from the hydrolysis of adenosine triphosphate (ATP); and 2-secondary active transport, which requires an electrochemical gradient generated by pumping ions in/out of the cell. The case above described represent a type of secondary transport active because the movement of sodium (Na) ions is used as energy source to move glucose molecules against their concentration gradient.
Answer: Transport of sodium ions down their electrochemical gradients facilitates the transport of glucose against its concentration gradient.
PLSSS HELPPPPPP
5. How does low biodiversity impact the stability of a tundra ecosystem?
4. Who else benefits from polar bear hunting?
3. Describe a polar bears niche.
1. How do tundra ecosystems in biodiversity compare in biodiversity to other types of ecosystems?
Answer: 5. Biologically numerous groups also are much more likely to include species that confer resilience to that ecosystem due to the fact as a network accumulates species, there may be a better risk of anybody of them having developments that permit them to conform to a converting environment.
3. The polar bear's ecological niche is that of a specialized predator of seals. When there are numerous seals around, adult polar bears will usually devour the blubber (fat) and pores and skin of the seals, which gives an awesome supply of energy. Younger bears will devour beef because the protein allows them to grow.
Explanatation:
Got them from g o o g l e but kind of change it up a bit
1. How do tundra ecosystems in biodiversity compare in biodiversity to other types of ecosystems?
Answer: Ecosystems in the arctic tundra are an example of those where there are fewer species overall than in other kinds of ecosystems.
2. What is a niche?
Answer: a role that a species plays in the ecosystem
3. Describe a polar bear's niche.
Answer: Some animals gain from polar bears' hunting of seals. A polar bear will leave behind significant portions of a seal after eating all of it. In tundra environments, these leftovers are a source of food for Arctic foxes, gulls, and other birds, particularly during the chilly winter months when there is nothing to eat. Healthy polar bear populations can have a good effect on other species' numbers, such as those of birds or Arctic foxes. Numerous other species are harmed when polar bear populations drop.
4. Who else benefits from polar bear hunting?
Answer: Arctic foxes, gulls, and other birds
5. How does low biodiversity impact the stability of a tundra ecosystem?
Answer: The species that provide resilience to an ecosystem are therefore far more likely to be found in biologically diverse groups because as a network accumulates species, there may be a greater chance that any one of them will have evolved to adapt to a changing environment.
4. Calculate the kinetic energy of a Hollywood star running from the paparazzi. The star's mass is 45.0 kg, and the star is running at
a velocity of 3.00 m/s.
a) 203 J
b) 303.75 J
c) 405 J
d) 67.5 J
Answer:
i do not know
Explanation:
Answer:
A
Explanation:
=122
I need help with question 54 .
Answer: D
In the laboratory, under favorable conditions, a bacterial population will grow exponentially, but in the real environment, these favorable conditions do not always exist.
1. If a long tail is a dominant characteristic, in which case is the characteristic of a long tail definitely expressed?
A) when at least one allele contains instructions for a long tail
B) when at least one parent has a long tail
C) when both alleles contain instructions for a long tail
D) when both parents have a long tail
2. What is true of all body cells except sex cells?
A) Each cell type carries chromosomes and genes that identify it as that specific type of cell. For example, skin cells have different chromosomes and genes than muscle cells.
B) Each body cell contains the same number and kinds of chromosomes for that organism. The chromosomes contain the same number and kinds of genes for that individual.
C) While each cell type in the body contains the same kinds of genes, they are organized on different chromosomes depending on the cell type.
D) While each cell in the body contains the same number of chromosomes, each cell type has different genes along those chromosomes.
Answer:
1. A) when at least one allele contains instructions for a long tail
2. B) Each body cell contains the same number and kinds of chromosomes for that organism. The chromosomes contain the same number and kinds of genes for that individual.
Answer:
A. when at least one allele contains instructions for a long tail
Explanation:
The guy above me Answered. oh yeah, also have a cheeseburger while your at it. lol