The Metzgers want to seed theirbackyard. The seed they selectcovers 375 m² per box. Howmany boxes of seed will theyneed to buy? Use the yarddiagram. Round any portionof a box to the next box?

The Metzgers Want To Seed Theirbackyard. The Seed They Selectcovers 375 M Per Box. Howmany Boxes Of Seed

Answers

Answer 1
Seeding the backyard

In order to find how many boxed they need, first they need to know the area they will have to cover:

In order to find it, we have find the total area of the rectangle and take off the area of the House and the area of the shed:

We know that all those areas are rectangles, their area are found multiplying their sides lenght:

House area = 5m x 16m = 80m²

Shed area = 3m x 3m = 9m²

Since the lateral side of the total area is

5m + 16m + 5m = 26m, then

Total area = 26m x 50m = 1300m²

Then, the area they need to cover is

total area - house area - shed area = 1300m² - 9m² - 80m²

= 1211m²

Since the seed they select covers 375 m² per box, in order to find how many boxes they need, we just need to divide the area they are going to cover with this number:

1211m² ÷ 375 m² = 3.229

We round it to 4 boxes as indicated.

Answer: they need to buy 4 boxes of seeds

The Metzgers Want To Seed Theirbackyard. The Seed They Selectcovers 375 M Per Box. Howmany Boxes Of Seed
The Metzgers Want To Seed Theirbackyard. The Seed They Selectcovers 375 M Per Box. Howmany Boxes Of Seed

Related Questions

Question content area top
Part 1
A ramp forms the angles shown to the right. What are the values of a and​ b?

Answers

Answer:

A=151

B= 29

Step-by-step explanation:

In ️FGH, f=65 inches, g=48 inches and h=70 inches. find the measure of

Answers

Let's take a look at our triangle:

Using the law of cosines, we'll get that:

[tex]G^2=F^2+H^2-2FH\cos \angle G[/tex]

Solving for angle G, we'll get:

[tex]\begin{gathered} G^2=F^2+H^2-2FH\cos \angle G \\ \rightarrow2FH\cos \angle G^{}=F^2+H^2-G^2 \\ \rightarrow\cos \angle G=\frac{F^2+H^2-G^2}{2FH} \\ \\ \rightarrow\angle G=\cos ^{-1}\frac{F^2+H^2-G^2}{2FH} \end{gathered}[/tex]

This way,

[tex]\begin{gathered} \angle G=\cos ^{-1}\frac{65^2+70^2-48^2}{2(65)(70)} \\ \\ \Rightarrow\angle G=41 \end{gathered}[/tex]

A person is riding a 14 kg bike at velocity of 18m/s. The mass of the person is 60kg. What is the momentum of the person and the bike?

Answers

The momentum of the person is zero and the momentum of the bike is 1332.

A person is riding a 14 kg bike at velocity of 18m/s

The momentum of bike = mass x velocity

p = (14 + 60) 18

= 1332

The velocity of the person with respect to the bike is 0

p = mv

p = 60 x 0

p = 0

Therefore, the momentum of the person is zero and the momentum of the bike is 1332.

To learn more about momentum refer here

https://brainly.com/question/7538238

#SPJ1

PLEASE I NEED HELP RIGHT AWAY


What is the equation in point-slope form of the line that passes through the points (7, 5) and (−4, −1) ?

Responses

y+4=11/6(x+1)
=

y+1=6/11(x+4)


y−1=6/11(x−4)


y+1=6/7(x+4)

Answers

y+1=6/11(x+4) is the equation in point-slope form of the line that passes through the points (7, 5) and (−4, −1).

What is Slope of Line?

The slope of the line is the ratio of the rise to the run, or rise divided by the run. It describes the steepness of line in the coordinate plane.

The slope intercept form of a line is y=mx+b, where m is slope and b is the y intercept.

The slope of line passing through two points (x₁, y₁) and (x₂, y₂) is

m=y₂-y₁/x₂-x₁

The given two points are  (7, 5) and (−4, −1)

m=-1-5/-4-7

=-6/-11

=6/11

The point slope intercept form is y- y₁=m(x-x₁) through (-4,-1)

y-(-1)=6/11(x-(-4))

y+1=6/11(x+4)

Hence, y+1=6/11(x+4) is the equation in point-slope form of the line that passes through the points (7, 5) and (−4, −1).

To learn more on slope of line click:

https://brainly.com/question/14511992

#SPJ1

Answer these two questions

Answers

For PART A: the height of the pole in the right angle triangle is 30 ft and the correct option is C

For PART B: the lenght of wire 1 in the right angle triangle is 45 ft and the right option is D

What is a right angle triangle?

A right-angled triangle is a polygon of three sides having one angle as 90 degrees(right angle).

Part A

To calculate the height of the pole in the right angle triangle, we use the formula below.

Formula:

tan∅ = opposite/adjacent

From the diagram,

Given:

∅ = 41°Opposite = Height of the pole = PAdjacent = 34 ft

Substitute these values into equation 1 and solve for P

tan41° = P/34P = 34×tan41°P = 29.55P ≈ 30 ft

Part B

Similarly, fine the length of wire 1, we use the formula below.

Formula:

cos∅ = Adjacent/Hypotenus.......... Equation 2

From the diagram,

Given:

Hypotenus = Wire 1 = x∅  = 41°Adjacent = 34 ft

Substitute these values into equation 2 and solve for x

cos41° = 34/xx = 34/cos41°x = 45.05x ≈ 45 ft

Hence, the height of the pole is 30 ft and the lenght of wire 1 is 45 ft.

Learn more about right angle triangle here: https://brainly.com/question/64787

#SPJ1

A car is traveling at a steady speed. It travels 2 1/3 miles in 3 1/2 minutes. How far will it travel in 49 minutes​? In ​one hour?

Answers

In 49 minutes the car will travel 2/147 miles

In 60 minutes the car will travel 1/90 miles

How to determine how far the car will travel in 49 minutes

The concept of average speed is used here. The formula is

= distance covered / time

= 2 1/3 / 3 1/2

= 2.3333 / 3.5

= 2/3

= 0.6667 miles per minutes

In 49 minutes

2/3 = distance  / 49

distance = 2/3 / 49

distance  = 2/147

= 0.0136 miles

In one hour = 60 minutes

distance = 2/3 / 60

distance = 1/90

= 0.0111 miles

Learn more about distance covered here:

https://brainly.com/question/29225098

#SPJ1

Rewrite the following rectangular equation in polar form assuming a is a real constant.x2 + y2 = 11a=

Answers

Answer:

The polar form is

r = √11a

Explanation:

The given equation is

x^2 + y^2 = 11a

Recall,

x = rcosθ

y = rsinθ

By substituting these values into the equation, we have

(rcosθ )^2 + ( rsinθ)^2 = 11a

r^2cos^2θ + r^2sin^2θ = 11a

r^2cos^2θ + r^2sin^2θ - 11a = 0

By factorizing r^2, we have

r^2(cos^2θ + sin^2θ) = 11a

Recall, cos^2θ + sin^2θ = 1

Thus, we have

r^2 = 11a

Taking the square root of both sides,

r = √11a

The polar form is

r = √11a

In​ 2005, 10.9 out of every 50 employees at a company were women. If there are 41,646 total company​ employees, estimate the number of women.

Answers

Number of women's are 9,078.83.

What is Proportional?

Any relationship that is always in the same ratio and quantity which vary directly with each other is called the proportional.

Given that;

In​ 2005, 10.9 out of every 50 employees at a company were women.

Now,

Since, In​ 2005, 10.9 out of every 50 employees at a company were women.

Let number of women's in 41,646 total company​ employees = x

So, We can formulate by the definition of proportion as;

⇒ 10.9 / 50 = x / 41,646

Solve for x as;

⇒ 10.9 × 41,646 / 50 = x

⇒ x = 9,078.83

Thus, Number of women's are 9,078.83.

Learn more about the proportion visit:

https://brainly.com/question/870035

#SPJ1

Annie wants to arrange several plates of fruit so that each plate
has the same number of apples and the same number of apricots.
What is the greatest number of plates Annie can arrange if she
plans to use 8 apples and 20 apricots? How many apples and
how many apricots will be on each plate?

Answers

The greatest number of plates Annie can arrange if she plans to use 8 apples and 20 apricots is 4 plates.

The number of apples Annie can arrange on each plate is 2The number of apricots Annie can arrange on each plates is 5

What is the greatest number of plates Annie can arrange?Number of apples = 8Number of apricots = 20

To find the greatest number of plates Annie can arrange, find the greatest common factor of and 20;

8 = 1, 2, 4, and 8

20 = 1, 2, 4, 5, 10, and 20

The greatest common factor of 8 and 20 is 4

Number of apples on each plate = 8/4

= 2

Number of apricots on each plate = 20/4

= 5

In conclusion, the greatest number of plates is 4 consisting of 2 apples and 5 apricots each.

Read more on greatest common factor:

https://brainly.com/question/219464

#SPJ1

Answer:

Step-by-step explanation:

i am also confused with this one so...

hehe

hehe

hehe

Mr. Jones bought 2 and 1/7 lb. of salmon. He cooked 1/5 of it for lunch. How much salmon did he have left over?

Answers

Answer:

[tex]1\frac{5}{7}\text{ lb}[/tex]

Step-by-step explanation:

First, convert [tex]2\frac{1}{7}\text{ lb}[/tex] to an improper fraction (to make the math easier):

[tex]2\frac{1}{7}=\frac{15}{7}\text{ lb}[/tex]

Next, since the question asks about how much salmon is left over, find that fraction. After cooking one-fifth of the salmon, four-fifths remain:

[tex]\frac{5}{5}-\frac{1}{5}=\frac{4}{5}[/tex]

Then, multiply the two:

[tex]\frac{15}{7}\times\frac{4}{5}=\frac{60}{35}\text{ lb}[/tex]

Finally, convert back to a mixed fraction:

[tex]\frac{60}{35}\text{ lb}=1\frac{25}{35}\text{ lb}=1\frac{5}{7}\text{ lb}[/tex]

Which relation is NOT a function?*I am going to send you my answer choices *

Answers

th first pic is not a function because a function dont have to values for the same x

the second pic is a function because each value of x has a different result

the third pic is a function because each value of x has a different result

so the first relation is not a function


Write each equation in slope intercept form.
12x + 4y = 8

Answers

Slope-intercept form:

This is a way we can organize a linear equation:

[tex]y=mx+b[/tex]

m = slopeb = y-intercept

Solving the Question

We're given:

[tex]12x + 4y = 8[/tex]

To organize this equation in slope-intercept form, we have to focus on isolating y:

[tex]12x + 4y = 8\\4y = - 12x +8\\y = - 3x +2[/tex]

Answer

[tex]y = - 3x +2[/tex]

The answer is y= negative 3 plus 2

help fast!
make up a word problem that can be represented with y=3.5x

Answers

The equation can be used for "the total cost of buying x chocolate bars, such that each one costs $3.50"

How to make a word problem that can be represented by that equation?

Here we have the linear equation:

y = 3.5*x

And we want to make a word problem that can be represented by this.

The simplest example would be something like "the total cost of buying x items of a cost equal to the constant of proportionality"

So let's suppose that there is a chocolate bar in a given store that costs $3.50 per unit.

So, if you buy x of these, the total cost will be modeled (in dollars) by the equation:

y = 3.50*x

Which is the same equation that we have above:

y = 3.5*x

Where the second 0 on the constant factor is trivial and can not be written.

Learn more about linear equations:

https://brainly.com/question/1884491

#SPJ1

What is a proportional relationship in YOUR OWN WORDS

Answers

If all of the ratios of the variables are equal, then there is a proportional link between the two variables.

Explain about the proportional relationship?

One variable is usually a constant value multiplied by the other in proportional interactions. The proportionality constant is the name given to the constant value.

A set of equal ratios connected to one another by a constant of proportionality make up a proportional relationship between two quantities. Different, related representations of proportional connections include tables, equations, graphs, and written descriptions.

We'll now look at a real-world illustration of a proportionate relationship: There is a correlation between the quantity of fuel we put in our car's tank and the price we will have to pay when we fill it up. In other words, we will pay more money the more gas we put in.

To learn more about proportional relationship refer to:

https://brainly.com/question/23318486

#SPJ1

The table compares the time at which Layne got on the bus to school (in minutes after 8am) and the duration of the ride(in minutes after 8 am) and the duration of the ride(in minutes), for several days.Can the duration of the ride be represented as a function of the time layne got on the bus?

Answers

ANSWER

Yes, it can.

EXPLANATION

First of all, let us sort the data according to increasing value:

Time (minutes) 18 20 20 22 22 23 25 30

Duration (minutes) 38 40 42 41 42 44 47 52

As we can already see, the duration of the ride seems to increase as the amount of time after 8 am that she got on the bus.

This means that the Duration of the ride and the time Layne got on the bus have a linear relationship and so, YES, the duration of the ride can be represented as a function of the time Layne got on the bus.

Together, the areas of the rectangles sum to 30 square centimeters.

Answers

Solution

Area of the rectangle = length x breadth

A. Write an equation to showing relationship between x and y:

[tex]\begin{gathered} \text{Area = length x breadth} \\ A=l\text{ x b} \\ A_1=3x \\ A_2=2y \end{gathered}[/tex][tex]\begin{gathered} A_1+A_2=30_{} \\ 3x+2y=30 \end{gathered}[/tex]

The equation for the relationship between x and y is

3x + 2y = 30

based on historical data, your manager believes that 35% of the company's orders come from first-time customers. a random sample of 62 orders will be used to estimate the proportion of first-time-customers. what is the probability that the sample proportion is less than 0.28?

Answers

The probability of the company's order from first-time customers with the sample proportion less than 0.28 will be 0.6103.

Total percent of company’s orders from first-time customers are 35%

Probability of the company's orders from first-time customers are 35/100 = 0.35.

Total number of customers in the random sample is 62.

Minimum given probability of company’s order from first time customers is 0.28

And the minimum probability of company’s order not from first time customers will be 1 - 0.28 = 0.72

Therefore,

As per the given question, Let P(z<0.28) is the required probability, where

Z = (0.28 - 0.35)/sqrt(0.28x0.72/62)

  = (0.28 - 0.35)/sqrt(0.28x0.0112)

  =(0.28 - 0.35)sqrt(0.003250)

  = (-0.07)/sqrt(0.003250)

  = -0.07/0.057

  = -1.228

From the z-score, we can get P( z<0.28 ) = 0.6103 ( From standard normal table )

To know more about z-score, visit here:

https://brainly.com/question/15016913

#SPJ4

Please i need your help! What is the slope of each line segment of QRS

Answers

Answer:ez 90 degrees

Step-by-step explanation:

[tex]g(x) = 3 log(x + 7) - 8[/tex]is this function increasing or decreasing?

Answers

Given function : g(x)=3log(x+7) -8

A function is said to be increasing if the derivative of the function is greater than 0,

and it said to be decreasing tof the derivative of the function is less than 0,

Differentiate the given function with respect to x,

[tex]\begin{gathered} g(x)=3\log (x+7)-8 \\ \frac{dg(x)}{dx}=\frac{d(3\log (x+7)-8)}{dx} \\ g^{\prime}(x)=3\frac{d\log (x+7)}{dx}-\frac{d(8)}{dx} \\ g^{\prime}(x)=\frac{3}{x+7}-0 \\ g^{\prime}(x)=\frac{3}{x+7} \\ \text{ since if x}>7\text{ then the function will be negative, } \\ g^{\prime}(x)<0, \\ \text{thus function at }7Answer :

at x >7 , the function g(x) will be decreasing

at x <7 the function g(x) will be increasing.

Find the area of the polygon. (hint: you need to solve for missing apothem or sides).Also round the area to the nearest whole number

Answers

Solution

The hexagon given is a regular hexagon. With apothem of 15 in

Area of a hexagon =

[tex]\begin{gathered} =\frac{1}{2}\times a\times P \\ \text{where a = apothem} \\ p=\text{perimeter of the hexagon} \end{gathered}[/tex]

Let us calculate the perimeter of the hexagon

From the triangle above,

[tex]\begin{gathered} \text{tan 60=}\frac{15}{x} \\ x\text{ tan 60 = 15} \\ x=\frac{15}{\tan 60} \\ x=5\sqrt[]{3} \end{gathered}[/tex][tex]\text{The side length of the hexagon = 2x = 2(5}\sqrt[]{3})\text{ = 10}\sqrt[]{3}\text{ in}[/tex][tex]\text{The perimeter of the hexagon = 6 x 10}\sqrt[]{3}\text{ = 60}\sqrt[]{3}\text{ in}[/tex][tex]\begin{gathered} \text{Area of the hexagon = }\frac{1}{2}\times a\times P \\ =\frac{1}{2}\text{ x 15 x 60}\sqrt[]{3} \\ =779.42in^2 \\ \\ Hence,\text{ the area of the polygon is }779in^2\text{ (to nearest wholw number)} \end{gathered}[/tex]

Milo can run 12 miles in 60 minutes. He needs to reduce his time by 19%. Approximately how many minutes does he have to take off his time? Round to the nearest whole number.

Answers

Milo needs to cover 12 miles in 48.6 minutes, as the percentage.

What is percentage?

A percentage that represents a tenth of a quantity. One percent, denoted by the symbol 1%, is equal to one-hundredth of something; hence, 100 percent denotes the full thing, and 200 percent designates twice the amount specified. A portion per hundred is what the percentage denotes. The percentage refers to one in a hundred. The % sign is used to denote it.

Milo can run 12 miles in 60 minutes.

She needs to reduce the time by 19%

So we have to calculate the 19%of 60

= 19/100* 60

=57/5 minutes

= 11.4

So the time he needs to achieve will be 60-11.4 = 48.6 minutes.

Hence, he needs to cover 12 miles in 48.6 minutes.

Learn more about Percentage, by the following link.

brainly.com/question/843074

#SPJ1

Graph the linear inequality & find the coordinates 2x-y<2

Answers

Answer:

(1,0) (0,-2)

Step-by-step explanation:

Use the future value formula to find the indicated value.FV = $3648, n = 22; i = 0.08; PMT = ?PMT =?(Round to the nearest cent.)

Answers

To calculate the periodic payment (PMT) we use the following formula:

[tex]\text{PMT}=\frac{FV\times i}{(1+i)^n-1}[/tex]

Where "FV" is the Future Value, "i" is the interest rate, and "n" is the number of periods. Replacing the known values we get:

[tex]\text{PMT}=\frac{3648\times0.08}{(1+0.08)^{22}-1}[/tex]

Solving the operations:

[tex]\text{PMT}=52.68[/tex]

I need help again, please.

Answers

Answer:

:-f(x)=x²-2x-24

Step-by-step explanation:

according to the rules of polynomial

f(-4) is the same thing as (x+4)

f(6) is the same thing as (x-6)

how?

x+4=0; x=-4

x-6=0; x=6

(x+4)(x-6)

x²-6x+4x-24

x²-2x-24

:-f(x)=x²-2x-24

award me

What is the value of the missing exponent in the equation 652 : 10- = 0.652?

Answers

Given the following expression:

[tex]\frac{652}{10^{^-}}=0.652[/tex]

notice that the right side of the equation has a decimal number that goes up to the thousandth, therefore, the missing exponent in the equation is 3, since:

[tex]\frac{652}{10^3}=\frac{652}{1000}=0.652[/tex]

help meeeeeeeeeeeeeee pleaseeeeeee

Answers

Answer: 9.7 seconds

Step-by-step explanation:

[tex]16t^2 =1503\\\\t^2 =1503/16\\\\t=\sqrt{1503/16} \text{ } (t > 0)\\\\t \approx 9.7[/tex]

2. Identify the vertex from the quadratic function y=-5(x-6)^2+8 *

Answers

The given function is

[tex]y=-5(x-6)^2+8[/tex]

This equation represents a parabola which is expressed in its vertex form

[tex]y=a(x-h)^2+k[/tex]

Where (h,k) is the vertex. Using this rule, the vertex of the given parabola would be (6,8).

Therefore, the answer is (6,8).

A line segment is graphed on the coordinate plane. What point divides this segment in the ratio 2:3 ?

Answers

we have the points

A (1,-2) and B(5,3)

Find out the point (x,y) that divide the segment AB in a ratio 2:3

that means

AX/XB=2/3

step 1

Find out the horizontal distance AB

ABx=5-1=4 units

Find out the vertical distance AB

ABy=3-(-2)=5 units

step 2

we have that

the horizontal distance between A and x is

AX/XB=2/3

AX=(2/3)XB -----> equation 1

AX+XB=4 -----> equation 2

substitute equation 1 in equation 2

(2/3)XB+XB=4

(5/3)XB=4

XB=12/5

XB=2.4

the x-coordinate of X is

x=5-2.4=2.6

Find out the y-cpoordinate

AX=(2/3)XB -----> equation 1

AX+XB=5 ------> equation 2

substitute equation 1 in equation 2

(2/3)XB+XB=5

5/3(XB)=5

XB=3

the y-coordinate of X is

y=3-3=0

answer is

the coordinate of the point is (2.6,0)

answer is option A

Lines AB and CD are straight lines. Find x and y. Picture attached/

Answers

By using properties of angles, it is obtained that

x = 18.5°, y = 37°

Angle

When two straight lines intersect, an angle is formed. The point of intersection is called the vertex of the angle and the lines are called the arms of the angle.

Here,

[tex]\angle COF = 90^{\circ}\\[/tex]

By the problem,

4x + 90  + 16 = 180 [Angle on a straight line]

4x + 106 = 180

4x = 180 - 106

4x = 74

[tex]\\x = \frac{74}{4}\\x = 18.5^{\circ}[/tex]

AB and CD are straight lines

[tex]\angle DOB = 16^{\circ}[/tex]  [Vertically opposite angle]

By the problem,

90 + 2y + 16 = 180 [ Angle on a straight line]

2y  + 106 = 180

2y = 180 - 106

2y = 74

[tex]y = \frac{74}{2}\\y = 37^{\circ}[/tex]

To learn more about angle, refer to the link-

https://brainly.com/question/25716982

#SPJ1

Enter your answer and show all the steps that you use to solve this problem in the space provided. Convert the map scale to a unit rate. How many inches represent one mile? Show your work. Interpret the meaning of the unit rate. 3/ 10 in . = 7 /8 mi . please fast i dont have much time

Answers

The map, every 1-inch drawing represents 2.917 miles in reality, using conversation.

What is conversation ?

A unit's use depends on the context; for example, a room's area is expressed in metres, yet a pencil's length and thickness are expressed in centimetres and millimetres, respectively.

Therefore, converting one unit to another is necessary. We must first understand the link between units in order to comprehend the concept of unit conversion.

When addressing many problems in mathematics, unit conversion is necessary. Mathematical conversions are necessary to perform the necessary calculations.

In the map, every 1 inch drawing represents 2.917 miles in reality.  

the meaning of the unit rate. 3/ 10 in. = 7 /8 mi

1 in = (7/8) mi ÷ (3/10)

= 7/8 * (10/3) = 70/24

1 in = (70/24) mi

Hence the map, every 1-inch drawing represents 2.917 miles in reality.

Learn more about  conversation, by the following link

https://brainly.com/question/141163

#SPJ1

 

Other Questions
Business is projected to be booming afterthe latest release of The Fast and theFurious 3.14159265359... Carver's AutoCustom must determine how many cansof paint and rims to stock at theirShanghai location.The Carver Family did choose WarehouseSpace A. The warehouse includes 8000sq. ft. of showroom and workshop space.One half of this warehouse space will beused to stock paint cans and rims. Thewarehouse has a height of 20 ft.Calculate the maximum numberof cylindrical paint cans thatCarver's Auto Custom can stock,if the paint comes in a 2-packhazmat box that measures 15 A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write the mRNA that would be transcribed from this DNA fragment.b) Circle the starter and the stopper in your mRNA sequence. Write the sequence of amino acids which would be encoded in translation. Use the mRNA codon table provided.c) Where in the cell do transcription and translation occur? Show your steps when solving the problem below. Container A has 800 mL of water and is leaking 6 mL per minute. Container B has 1,000 mL of water and is leaking minute. How many minutes will it take for the two containers to have the same amount of water? "For theWhich is a minor claim that should not be included ina summary? in the history of slavery in western civilization, the basic patterns of slavery were not racialized until? The table shows the highest maximum temperature for the month of October in Philadelphia Pennsylvania over the yearsPart A identify the independent and dependent quantity in their units of measure?Part B identify the equation of line of best fit using the data table.what is the slope and y-intercept of the line and what do they represent? How many times larger is 6 108 than 3 10-4? 7. Solve the following set of equations: 3x - 7y=-4 and 2x - 5y = -3a. (1, 2)b. (2, 1)c. (-2,-1)d. (1, 1)e. (-1,-1) You ordered from an online company. The original price of the item is $65. Theitem is on sale for 10%, and you have a coupon for an additional 15%. Applying onediscount at a time, what is the final price?$46.96$49.73$49.47$45.45 After the end of an advertising campaign, the daily sales of a product fell rapidly, with daily sales given by S=3800e0.05x dollars, where x is the number of days from the end of the campaign.a. What were daily sales when the campaign ended?b. How many days passed after the campaign ended before daily sales were below half of what they were at the end of the campaign? Joseline is trying out a new piece of photography equipment that she recently purchased that helps to steady a camera with one single leg instead of three. What type of equipment is Joseline trying out?A. multi-podB. tripodC. semi-podD. monopod DNA Extraction Lab. 1. Where did the DNA you are seeing come from? (Based on the method given below). Free Brainliest if right!Why is Mary Salter Ainsworth a central figure in psychology? Lila's retirement party will cost $8 if she invites 4 guests. If there are 9 guests, how much will Lila's retirement party cost? Solve using unit rates. Multiply binomial by polynomials In your own words, give a general description of the species, *wolf spiderIn your description make sure to include the scientific name and identification, its trophic level, its role in the food chain/web, and what biomes it may reside in. Please help 50 points!1.A cylindrical jar has a radius of 6 inches and a height of 10inches. The jar is filled with marbles that have a volume of 20 in3. Use 3.14 for pi. Show work. Complete sentences. What is the volume of the jar? do you know what complex numbers are? Can you divide two complex numbers? Give us an example here! the volume of a right cone is 27 units^3. if its height is 9 units find its circumference in terms of . 27y over 15y in lowest terms