Tell whether x and y show direct variation, inversevariation, or neither. Explain your reasoning.X 24.68y -5 -11 -17 -23The products xy areThe ratios Y areХSo, X and y show

Tell Whether X And Y Show Direct Variation, Inversevariation, Or Neither. Explain Your Reasoning.X 24.68y

Answers

Answer 1

Neither

1) Firstly, we can start filling in the blanks.

2) The products xy are:

[tex]xy=-10,-44,-102,-184[/tex]

We're simply multiplying each x-entry by its output y.

The ratios y/x are:

[tex]\frac{y}{x}=-\frac{5}{2},-\frac{11}{4},-\frac{17}{6},-\frac{23}{8}[/tex]

So, x and y show:

Note that xy is not constant, for their product differs. So it is not an

inverse variation.

On the other hand, y/x is not constant as well. So it is not a direct variation.

3) Hence, it's neither direct nor inverse.


Related Questions

Find the distance between (-5,3) and (-6,6).

Answers

[tex]\begin{gathered} \text{let (x}_1,y_1)=(-5,3)\text{ and (x}_2,y_2)=(-6,6) \\ \text{the distance is given by} \\ d=\sqrt[]{\text{(x}_2-\text{x}_1)^2+(y_2}-y_1)^2 \\ \text{hence, one has} \\ d=\sqrt[]{(-6-\mleft(-5\mright))^2+\mleft(6-3\mright)}^2 \\ d=\sqrt[]{(-6+5)^2+(3)}^2 \\ d=\sqrt[]{(-1)^2+9} \\ d=\sqrt[]{1+9} \\ d=\sqrt[]{10} \end{gathered}[/tex]

8 people have to give a presentation in class today. How many different orders can theyspeak in?65,5364,09640,32013,440

Answers

Answer:

They can speak in 40, 320 different orders

Explanation:

Given that 8 people have to give a presentation in class.

They can speak in many different orders:

First could be second, second could be first, third could be eight, seventh could be fifth, and so on.

This number of ways result in factorial 8.

This is written as:

[tex]8![/tex]

Which represents the multiplications of numbers on the number line from 8 down to 1.

That is:

[tex]\begin{gathered} 8!=8\times7\times6\times5\times4\times3\times2\times1 \\ \\ =40,320 \end{gathered}[/tex]

who can solve this for me it's due next class period

Answers

[tex]\begin{gathered} x\text{ = 12} \\ y\text{ = 12}\sqrt[]{2} \end{gathered}[/tex]

Here, we want to get the value of x

As we can see, we have the interior angle as 45;

The other is 90; and that means the last angle will be 45

This mean that we have an isosceles right-triangle

The sides that face the angles are equal

These sides are x and 12

That means x = 12

To get the value of y, we have to use the Pythagoras' theorem

The square of the hypotenuse (the longest side and the side that faces the right angle) is equal to the sum of the squares of the two other sides

The side facing the right angle is y

So, the sum of the squares of x and 12 will give the square of y

Mathematically, we have this as follows;

[tex]\begin{gathered} y^2=12^2+x^2 \\ \sin ce\text{ x = 12} \\ y^2=12^2+12^2 \\ y^2\text{ = 144 + 144} \\ y^2\text{ = 288} \\ y\text{ = }\sqrt[]{288} \\ y\text{ = 12}\sqrt[]{\text{ 2}} \end{gathered}[/tex]

write the decimal using number name,and unit form . 317.098

Answers

three hundred and seventeen and ninety-eight thousandths

Explanation:

3 = hundreds

1 = ten

7 = ones

Number after the decimal point start in ythe tenth place

0 = tenth

9 = hundredths

8 = thousandths

Naming the number:

three hundred and seventeen and ninety-eight thousandths

When you convert a number from decimal notation to scientific notation, how do you know if the exponent will be positive or negative? Explain.

Answers

When converting a number from decimal to scientific notation,

The exponent is positive if the movement of the decimal point is to the left

The exponent is negative if the movement of the decimal point is to the right.

Examples :

[tex]1200\rightarrow1.2\times10^3[/tex]

The decimal point moves from the right of the last digit to the place between 1 and 2. It moves to the left so the exponent is positive.

[tex]0.0012\rightarrow1.2\times10^{-3}[/tex]

The decimal point will move 3 places to the right, so the exponent will be negative.

Tala Abarkowe NAME PERIOD Unit 2 Lesson 5 Cool Down An albatross is a large bird that can fly 400 kilometers in 8 hours at a constant speed. Using d for distance in kilometers and t for number of hours, an equation that represents this situation is d = 50t. = 1) What are two constants of proportionality for the relationship between distance in kilometers and number of hours? Due in this s cose lh sud

Answers

Given relation is

[tex]d=50t[/tex]

Here, d is the distance in kilometers and t is the number of hours.

Since distance and time both vary, therefore, they are not constants.

The only value which is fixed is 50.

Therefore, the only constant of proportion is 50.

Since the ratio of two valus are constant, therefore, they are in direct proportional relationship.

From the given relation, we can write

[tex]t=\frac{d}{50}[/tex]

Hence, another relationship between d and t is

[tex]t=\frac{d}{50}[/tex]

Evaluate the expression when a =3 and x = - 5-8a + x

Answers

We have an expression:

[tex]-8a+x[/tex]

We have to evaluate it when a = 3 and x = -5. To do that we replace a and x by its values and calculate:

[tex]\begin{gathered} -8(3)+(-5) \\ -24-5 \\ -29 \end{gathered}[/tex]

Answer: the expression value is -29

The picture that I sent to the app would not pick up the greater or less than signs. The instructions say solve the system of inequalities by graphing. I would like someone to walk me through the steps. I had an amazing tutor the last time but my connection got lost she sent me a graph to help me.

Answers

See graph below

Explanation:

We have two inequalities:

y < 6

y > x + 3

To plot the inequalities on a graph, we change the inequality sign to equal to in order to get points to plot the graph:

y = 6

This means at y = 6, there will be an horizontal line for all values of x. But due to the less than sign, it means the horizontal line will be shaded down.

y = x + 3

We assign values to x inorder to get y values:

let x = -2, 0, 2, 4

when x = -2

y = -2 + 3 = 1

when x = 0

y = 0 + 3 = 3

when x = 2

y = 2 +3 = 5

when x = 4

y = 4 + 3 = 7

When we plot this points, we get a straight line. SInce the sign is greater than, the line will be shaded towards the positive side

plotting the graph:

First inequality

Both inequalities:

14. What property is used to show that 3(4-6) = 12-18?

Answers

Answer:

Distribution property method

There are approximately 2.54 cm in 1 inch. what is the distance in inches of 14 cm. use a proportion to solve and round your answer to the nearest 10th of an inch

Answers

Proportions

We know that there are 2.54 cm in 1 inch

2.54 cm ⇔ 1 inch

We want to find what is the distance in inches of 14 cm:

14 cm ⇔ ?? inch

Then, we have the following equivalence:

14 cm ⇔ ?? inches

2.54 cm ⇔ 1 inch

If we divide both sides of the equivalence we would have the same proportion:

[tex]\frac{14}{2.54}=\frac{?\text{?}}{1}[/tex]

Solving both sides of the equation:

[tex]\begin{gathered} \frac{14}{2.54}=\frac{?\text{?}}{1} \\ \downarrow \\ 5.51=\text{??} \end{gathered}[/tex]

This means that:

14 cm ⇔ 5.51 in

Rounding the answer

We want to round our result to the nearest tenth. This is a number with one digit after the decimal point:

5.51 in ≅ 5.5 in

Answer: the distance in inches of 14 cm is 5.5 in

a shop sells on average 250 can's of juice a day there are 25500 cans in stock how many days will these stocks last​

Answers

If a shop sells on average 250 can's of juice a day and  there are 25500 cans, these stocks last​ for 102 days

A shop sells on average 250 can's of juice a day, it has, it has 25500 cans in stock. We need to find the number of days these stocks will last.

The number of days can be found by using unitary method

1 can of juice is being sold in 1/250 day

25500 can of juice will be sold in 1/250 (25500)

25500 can of juice will be sold in 102 days

Therefore, if a shop sells on average 250 can's of juice a day and  there are 25500 cans, these stocks last​ for 102 days.

To learn more about unitary method refer here

https://brainly.com/question/24587372

#SPJ9

Let angle D be an acute angle and tan D = 0.72 . Use technology to approximate the measure of D to the nearest 10th of a degree.

Answers

D=35.8 °

Explanation

Acute angles measure less than 90 degrees, to solve this we need to use a calculator

Step 1

a) let

[tex]\begin{gathered} angle\text{ =D} \\ tan\text{ angle = }tan\text{ D=0.72} \end{gathered}[/tex]

, b) now, use the inverse tan function to isolate D

[tex]\begin{gathered} tan\text{ D=0.72} \\ inverse\text{ tan function in both sides} \\ \tan^{-1}(tan\text{ D\rparen=}\tan^{-1}(\text{0.72\rparen} \\ D=35.75388 \\ rounded \\ D=35.8\text{ \degree} \end{gathered}[/tex]

so, the answer is

D=35.8 °

I hope this helps you

i need help with my homework PLEASE CHECK WHEN DONE ANSWERING

Answers

Answer:

The sequence is given below as

[tex]8,11,14,17,20[/tex]

Step 1:

The nth term of an arithmentic progression is given below as

[tex]\begin{gathered} a_n=a+(n-1)d \\ where, \\ a=first\text{ term} \\ n=number\text{ of terms} \\ d=common\text{ difference} \end{gathered}[/tex]

To figure out the common difference, we will use the formula below

[tex]\begin{gathered} d=a_2-a_1=a_3-a_2 \\ d=11-8=14-11=17-14=20-17=3 \\ d=3 \end{gathered}[/tex]

Step 2:

The first term of the sequence is given below as

[tex]a=8[/tex]

Step 3:

Substitute the value of a and d in the formula below

[tex]\begin{gathered} a_{n}=a+(n-1)d \\ a_n=8+(n-1)3 \\ a_n=8+3n-3 \\ a_n=5+3n \end{gathered}[/tex]

Hence,

The final answer is

[tex]a_n=5+3n,where\text{ n=1,2,3,4,...}[/tex]

OPTION A is the right answer

The rectangular foor of a classrom is 30 feet in length and 24 feet in width. A scale drawing of the floor has a length of 5 inches. What is the perimeter, in inches, of the floor in the scale drawing?

Answers

The required perimeter of the scale drawing is given as 18 inches.

Given that,
The rectangular floor of a classroom is 30 feet in length and 24 feet in width. A scale drawing of the floor has a length of 5 inches. The perimeter, in inches, of the floor in the scale drawing, is to be determined.

What is the perimeter?

Perimeter is the measure of the figure on its circumference.

Here,
According to the question,

L = 30 feet, W = 24 feet,
for Scaled drawing
l = 5 inch, w = x
Now,
30/5 = 24 / x
6 = 24 / x
x = 24 {1/6}
x = 4,
So the width of the scale drawing is 4 inches,
perimeter of the scaled drawing  = 2[l + w]
                                                       = 2 [5 + 4] = 18 inches

Thus, the required perimeter of the scale drawing is given as 18 inches.

learn more about perimeter here:

brainly.com/question/6465134

#SPJ1

Simplify each expression using the order of operations. 3+(7−5)2×6= 25(4+4)×2= 8−6÷2+3×5= 7×3−15÷5= 8+2(1+12÷2)2=

Answers

Using the order of operation which states

[tex]\begin{gathered} B\Rightarrow Bracket \\ O\Rightarrow Orders \\ D\Rightarrow Division \\ M\Rightarrow Multilication \\ A\Rightarrow Addition \\ S\Rightarrow Subtraction \end{gathered}[/tex]

Expressions in brackets/parentheses are evaluted first, followed by expressions involving orders, division, multiplication, addition and subtraction in that order.

Thus,

1)

[tex]\begin{gathered} 3+(7-5)2\times6\text{ = ?} \\ \text{Evaluate expressions in parentheses. thus,} \\ 3+(2)2\times6 \\ \text{Evaluate expressions involving multiplication,} \\ 3+24 \\ \text{Add up the expressions,} \\ 3+24\text{ = 27} \end{gathered}[/tex]

thus, 3+(7−5)2×6 = 27

2)

[tex]\begin{gathered} 25\mleft(4+4\mright)\times2=\text{?} \\ \text{Evaluate expressions in parentheses. thus,} \\ 25(8)\times2 \\ \Rightarrow400 \end{gathered}[/tex]

thus, 25(4+4)×2 = 400

3)

[tex]\begin{gathered} 8-6\div2+3\times5\text{ = ?} \\ \text{Evaluate expressions involving division. thus,} \\ 8-3+3\times5 \\ \text{Evaluate expressions involving multipliation. thus,} \\ 8-3+15 \\ \text{Evaluate expressions involving addition. thus,} \\ 8+12 \\ \text{Add up the terms,} \\ 8+12\text{ = 20} \end{gathered}[/tex]

thus, 8−6÷2+3×5 = 20

4)

[tex]\begin{gathered} 7\times3-15\div5=\text{ ?} \\ \text{Evaluate expressions involving division. thus,} \\ 7\times3-3 \\ \text{Evaluate expressions involving multiplication. thus,} \\ 21-3 \\ \text{Subtract the terms,} \\ 21-3\text{ = }18 \end{gathered}[/tex]

thus, 7×3−15÷5 = 18

5)

[tex]\begin{gathered} 8+2\mleft(1+12\div2\mright)2=\text{ ?} \\ \text{Evaluate the terms in parentheses. thus,} \\ 8+2\times\: 7\times\: 2 \\ \text{Evaluate the terms involving multiplication. thus,} \\ 8+28 \\ \text{Add up the terms,} \\ 8+28\text{ = }36 \end{gathered}[/tex]

thus, 8+2(1+12÷2)2 = 36.

in quadrilateral ABCD shown below, AD is congruent to BD, m

Answers

We will use the next image

the angles in red are equals

The angle in blue is 30°

We need to remember that the sum of the interior angles of a triangle must be 180°

x is the red angle

2x+30=180

2x=180-30

x=150/2

x=75

the angle DBC can be calculated as a complementary angle, the complementary angle is formed with two angles that form an angle of 90°

angle DBC =90-75

angle DBC=15° the angle in green in the image

HW Score: 77 Score: 0 of 1 pt 15 of 18 (15 complete) v X 7.3.43 On a world globe, the distance between Chy A and Cycles that are actually 10.730 kilometers apart, is 132 inches. The actual distance between City C and City Dis 1500 kilometers How far apart are this globe? chy C and Cny D are inches apart on this giebe (Type an integer ordenalpadd to the manded) More Enter you are All parts showing Type here to search

Answers

13.2 inches is. 10,730

1500 km , how far apart are

Find X= (1500/10,730) = 150/1073= 0.14

then multiply by 13.2

13.2X = 1.85

Then ,in a globe , distance between C and D cities is 1.85 inches

Answer is 1.85 inches

Find the area of this circle please…Use 3 for pi

Answers

Given:

The radius of circle is 11 inch

The value for pi is 3

The objective is to find the area of the circle.

The area of the circle is given by the formula:

[tex]A=\pi\times r^2^{}[/tex]

Substituting ,r = 11

[tex]\pi=3[/tex]

We get:

[tex]\begin{gathered} A=\pi\times r^2 \\ =3\times(11)^2 \\ =3\times121 \\ =363 \end{gathered}[/tex]

Hence, the area of the circle is 363 square inches

Write an inequality for the problem and answer the question about the inequality. The square of x is greater than or equal to 10. Is 3 a solution.

Answers

"The square of x..." translates to

"...is greater than or equal to 10." translates to ≥ 10.

To determine if 3 is a solution, substitute 3 to the inequality.

[tex]\begin{gathered} x^2\ge10 \\ \text{If }x=3 \\ (3)^2\ge10 \\ 9\ge10 \\ 9\ngeq10 \end{gathered}[/tex]

The resulting number, 9 is not greater than 10. Therefore, 3 is not a solution.

Debra brought a desk on sale for $438. This price was 73% of the original price. What was the original price

Answers

Let x = the original price of the desk.

It's known that 73% of the price is $438, thus:

[tex]\frac{73}{100}x=438[/tex]

Multiplying by 100 and dividing by 73:

[tex]x=\frac{100\cdot438}{73}=600[/tex]

The original price of the desk was $600

Find the distance between the points (2, – 5) and ( – 7, – 7)

Answers

Answer:

=[tex] \sqrt{85} [/tex]

Step-by-step explanation:

let, (x1,y1) = (2,-5) & (x2,y2) = (-7,-7)

now, for distance between two points,

D = [tex]\sqrt[]{(x_{1}-x_{2} )^{2} +(y_{1}-y_{2} )^{2} }[/tex]

=[tex]\sqrt[]{(2-(-7))^{2}+(-5-(-7))^2 }[/tex]

[tex]=\sqrt{(2+7)^2+(-5+7)^2}[/tex]

[tex]=\sqrt{9^2+2^2}[/tex]

[tex]=\sqrt{81+4}[/tex]

[tex]=\sqrt{85}[/tex]

Answer:

[tex] \huge{ \boxed{ \sqrt{85} \: \text{or} \: 9.219 \: \text{units}}}[/tex]

Step-by-step explanation:

The distance between two points say [tex] A(x_1,y_1) [/tex] and B(x_2,y_2) can be found by using the formula;

[tex] \bold{d = \sqrt{{x_2-x_1}^{2}+{y_2-y_1}^{2}}} [/tex]

From the question the points are (2, – 5) and ( – 7, – 7)

[tex] x_1=2 \\ y_1=-5 \\ x_2=-7 \\ y_2=-7 [/tex]

Substituting the values into the formula that is;

[tex]d = \sqrt{ {( - 7 - 2)}^{2} + {( - 5 - - 7)}^{2} } \\ d = \sqrt{ {( - 9)}^{2} + {(2)}^{2} } \\ d = \sqrt{81 + 4} \\ d = \sqrt{85} = 9.219[/tex]

We have the final answer as

√85 or 9.219 units

I need help with this question. I have to show work

Answers

PART A:

Let the number of days be represented by t. Let the total cost be represented by C.

FOR COMPANY A:

The equation to represent the total charges will be given as

[tex]C=22t+5[/tex]

FOR COMPANY B:

The equation to represent the total charges will be given as

[tex]C=20t+16[/tex]

PART B:

Company B will charge less over a 9-day rental period.

To confirm this answer, we will calculate the cost using the equations derived above:

FOR COMPANY A:

[tex]\begin{gathered} C=22(9)+5 \\ C=198+5 \\ C=203 \end{gathered}[/tex]

FOR COMPANY B:

[tex]\begin{gathered} C=20(9)+16 \\ C=180+16 \\ C=196 \end{gathered}[/tex]

Therefore, COMPANY B will charge less over 9 days.

PART C:

To know how much is saved over a 15-day period, we will first calculate the cost of both companies over the period using the equations derived from Part A.

FOR COMPANY A:

[tex]\begin{gathered} C=22(15)+5 \\ C=330+5 \\ C=335 \end{gathered}[/tex]

FOR COMPANY B:

[tex]\begin{gathered} C=20(15)+16 \\ C=300+16 \\ C=316 \end{gathered}[/tex]

We can, thus, calculate the difference as

[tex]\begin{gathered} 335-316 \\ =19 \end{gathered}[/tex]

Therefore, the amount saved will be $19 over 15 days.

determine whether the equation below has a one solutions,no solutions, or an infinite number of solutions. afterwards, determine two values of x that support your conclusion.x-4=4-x

Answers

x - 4 = 4 - x

4 is subtracting on the left, then it will add on the right

x is subtracting on the right, then it will add on the left.

x + x = 4 + 4

2x = 8

2 is multiplying on the left, then it will divide on the right

x = 8/2

x = 4

So, there is only one solution

Fill in the blanks below.(a) Ivanna lost 40 dollars from her pocket.Write a signed number to represent this change.(b) A car corporation produced 540 more cars this month than last.Write a signed number to represent this month's change in production.

Answers

Recall that the signs

[tex]+,\text{ and -}[/tex]

helps us indicate if there is an increase or a decrease.

If the number represents a decrease from the previous one, we put a minus sign. If the number represents an increase then we put a plus sign.

Notice that Ivanna lost $40, therefore, the total money she had decreased by 40.

If the company produced 540 more cars this month than last month, then there was an increase of 540 in cars production.

Answer:

(a)

[tex]-40.[/tex]

(b)

[tex]+540.[/tex]

1. Given: f(x)=x²-5x +1
A) Which is larger f(2) or f(-2)?
B) Which is smaller f(0) or f(4)?

Answers

A. The function f(-2) is larger than f(2)

B. The function f(4) is smaller than f(0)

Given,

The function;  f(x) = x²- 5x + 1

We have to find;

A. The larger is f(2) or f(-2)

Here,

f(2) = 2²- 5 x 2 + 1 = 4 - 10 + 1 = - 6 + 1 = -5

f(-2) = -2²- 5 x -2 + 1 = 4 + 10 + 1 = 15

That is,

The function f(-2) is larger than f(2)

B. The smaller is  f(0) or f(4)

Here,

f(0) =  0²- 5 x 0 + 1 = 0 - 0 + 1 = 1

f(4) = 4²- 5 x 4 + 1 = 16 - 20 + 1 = - 4 + 1 = -3

That is,

The function f(4) is smaller than f(0)

Learn more about functions here;

https://brainly.com/question/28441347

#SPJ1

Which order pair makes both inequalities true? Y<-2x+3Y< x-2

Answers

The ordered pair which makes both inequalities true are (3, 0).

Inequalities are mathematical expressions where neither side is equal.

Contrary to equations, we compare two values in inequality.

Less than, greater than, or not equal to signs are used in place of the equal to sign in between.

Let us consider the ordered pair (3, 0)

In the first inequality

y > -2x + 3

Substituting the values of x and y

0 > -2(3) + 3

0 > -6 + 3

0 > -3

In the second inequality

y < x - 2

Substituting the value of x and y

0 < 3 - 2

0 < 1

Therefore, the ordered pair which makes both inequalities true are (3, 0).

To learn more about inequalities visit:

https://brainly.com/question/20383699

#SPJ9

Which expression fits this description? • The expression is the quotient of two quantities. • The numerator of the expression is the product of 5 and the sum of x and y. • The denominator is the product of negative 8 and x. 5x + y 5(x + y) - (8 + x) 5x + y –8+x 5(x + y) -82 - 8x Done -

Answers

Given the word problem:

The numerator of the expression is the product of 5 and the sum of x and y and The denominator is the product of negative 8 and x.

The numerator will be the value on top in a fraction.

Here, the numerator is the product of 5 and the sum of x and y ==> 5(x + y)

The denominator is the value below in a fraction.

Here, the denominator is the product of negative 8 and x ==> -8x

Therefore, the expression that fits this description is:

[tex]\frac{5(x+y)}{-8x}[/tex]

Help with this question please!!What are the coordinates of the vertex?

Answers

The coordinates of the vertex are:

[tex](-2,-4)[/tex]

G is located at (0, 4)What are the coordinates of G' after G undergoes the translation (x,y)-> (x-5,y+2)?

Answers

Applying the translation rule:

G(0, 4) → (0-5, 4+2) → G'(-5, 6)

simplify using distributive property 4(1 + 9x)

Answers

4(1 + 9x)

4 + 36x (Distributing)

The answer is 36x + 4

Other Questions
Write a program that asks the user to enter a city name, and then prints Oh! CITY is a cool spot. Your program should repeat these steps until the user inputs Nope.Sample RunPlease enter a city name: (Nope to end) San AntonioOh! San Antonio is a cool spot.Please enter a city name: (Nope to end) Los AngelesOh! Los Angeles is a cool spot.Please enter a city name: (Nope to end) PortlandOh! Portland is a cool spot.Please enter a city name: (Nope to end) MiamiOh! Miami is a cool spot.Please enter a city name: (Nope to end) Nope What is numeral value of 3/4 + 5/8 A cylinder shaped above ground pool is 4.5 deep. If the diameter of the pool is 16 ft, determine the capacity of the swimming pool in cubic feet. Write your awnser in terms of pi 6. 6.5 ounces g7.45 miles km8.2.3 miles cmCovert #6#7#8 How many electrons can be held in a sublevel l = 3? A gas occupies 12.3 L at a pressure of 40 mmHg. What is the volume when the pressure is increases to 60 mmHg? Which of the following notations correctly describe the end behavior of the polynomial graph below? Write an inequality for the word problem and answer the question about the inequality. Eric has an equal number of dimes and quarters that total less than 4 dollars. Could he have 12 dimes The question is in the picture. Using the answer choice word bank, fill in the proportion to find the volume of the larger figure. Why is the population of the Manufacturing Belt shrinking while the population of the Sunbelt is growing? The restriction enzyme EcoR1 recognizes the DNA sequence GAATTC. Which DNA strands will be cut byEcoR1?i. TTCAGGAATTCGGAAACCAAGTCCTTAAGCCTTTGGii. TGAATCGAACCTGACTTAGCTTGGACiii. TTAAGCGGCCGAATTCAGTCCAAATTCGCCCGCTTAAGTCAGGTiv. CAGTAGGATTTCTGTGTCGTCATCCTAAAGACACAG 30 POINTS PLS HELPBecause it is so popular, a store owner increases the cost of a toy by $4.99. The new cost of the toy is $14.84. (a)Write an equation that represents the situation. Use c to represent the original cost of the toy. (b)Solve the equation using a related equation. Show your work.(c)What does the solution of the equation represent? Can someone help me on this Im confused According to the phase diagram for HO, what happens to the phases ofwater at 0.5 atm pressure as the temperature is decreased from 110C to -10C?A) water changes from a gas to a solid to a liquidB) Water changes from a solid to a liquid to a gasC) water changes from a liquid to a gas to a solidD) water changes from a gas to a liquid to a solid Gimme answer please graph the function, not by plotting points, but by starting from the graph of y=e^x in the figure below.the function is: y= e^-x -1?? I need help finding the asymptote?? The neutrons within the nucleus of an atom have what charge?Question 15 options:negativesame as an electronsame as a protonno charge Thesis statement on earthquakes 7/10 3/10 solve complex fraction The circumference of a circle is 24 in. What is the area, in square inches? Express your answer in terms of .