Please help me in science!

Answer:

B. Break down the organic matter of dead plants and animal

Answer:

seed cones and pollen cones

Explanation:

In gymnosperms, their reproductive structures include the pollen cones, which produce pollen grains or the male gametophyte; and the seed cones, which produce female gametophyte.

Answer:

The Answer Is "Cones"

Explanation:

Why?  Well, the cones spread from the male cones to the female cones... Then, the female cones put this sticky stuff on the cone called, " Ovule" Finally, it creates the cycle once again.

Also, have a mythical day!!!

Answer:

flase

Explanation: photosynthiesis is oxygen and carbon dixocide

Answer:

false

Explanation:

The byproduct of photosynthesis is oxygen not nitrogen

Answer:

DNA is a self replicated material that is inside almost every living animal, and human being. DNA contains genetic codes. Dna holds genes, for example those who created you, there genes are passed on to you causing it to also be in ur DNA. It contains instructions that an organism needs to live, develope and reproduce. DNA serves as the primary unit of heredity in different types of organisms. (It might not be long enough but maybe this could atleast be used as half a paragraph)

Answer: I cant say for sure how many species have to be extinct. But yes a species can become extinct.

Explanation:

Answer: The answer is A

The moon has moved past the 1st quater and is heading to the full moon

Answer: Than answer to this question is C

Explanation: The waxing gibbous moon is the last phase before the next full moon.

Answer:4,500

Explanation:6mm times 750 equals 4,500

Answer:

yes

Explanation:

Altitude is an elevation from the sea level. It plays an important role in animals as it affects the respiratory rate, pressure on the cells, and homeostasis.

Respiratory rate is the breathing that involves the inhalation and exhalation of gases through the respiratory system. The breathing rate is reduced due to decreases in oxygen transport at a higher altitude which causes fatigue.

At higher altitudes, the pressure is more and in turn, affects the cells as the body also maintains an osmotic pressure to balance the fluid and internal organs. As the altitude increases the temperature drops which affects the homeostasis of the body resulting in more use of energy to keep warm.

Therefore, altitude affects respiration, cell pressure, and homeostasis.

Learn more about respiratory rate here:

https://brainly.com/question/13139675

#SPJ2

Answer:

AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG

Explanation:

this is the complementary strand for the mRNA.

A=U

C=G

G=C

T=A

this is the key for any mRNA strand.

;)

Answer:

a

Explanation:

bb

Answer:

More specifically, biomes are determined primarily by temperature and precipitation and altitude is going to have effects on both temperature and precipitation. As altitude increases, temperature decreases. ... Thus, altitude is going to affect both temperature and precipitation which will affect the composition of biome.

Answer:The correct answer is B

Explanation:

I hope this helps you out!

From the image, the letter that represents the enzyme is B.

Enzymes are substances, made up of proteins, which are capable of speeding up the metabolic reactions in the human body.

There is a theory that explains the mechanism of action of enzymes. This is called the enzyme lock and key theory.

This theory states that enzymes bind to substrates temporarily forming enzyme-substrate complex that appears like the fitting of a lock and key.

This simply means that the same way a particular key can only fit into a particular lock is the same way a particular substrate must combine with  a particular enzyme for a reaction to occur.

From the diagram,

B represents the enzyme with an active site which must fit into a substrate

A represents the substrate.

Therefore, the the letter that represents the enzyme is B.

Learn more here:

https://brainly.com/question/13981863

Answer:

1. False

2. True

3. True

4. True

Explanation:

1. Not all mutations are bad! Some actually can provide people with advantages.

2. Back to number 1, yes! Some mutations can give you advantages that people would not normally have.

3. Yes! Melanin helps protect our skin from damage from UV rays from the sun. This is why people with lighter skin tend to “tan” or “burn”.

4. Yes! Mutations are often a random process. We cannot determine whether or not someone will be born with or without a mutation.

Answer:It allows beetles to escape from predators.

Explanation:

Answer:

Explanation:

Kingdom fungi

The organism which has many cells, cannot move and cannot photosynthesize belongs to kingdom fungi

Organisms in kingdom fungi are:

Multicellular organisms are organisms which possesses two or more cells. They are described as many celled organisms.

Learn more about multicellular organisms:

https://brainly.com/question/9989716

The physical and chemical properties of each element distinguishes form all others elements, all these properties depends upon the number of protons present in an element. Thus, the correct option is D.

A chemical element is a species of atoms which contain the same number of protons in the nucleus. Unlike the chemical compounds, elements present in the periodic table cannot be broken down into simpler substances by any chemical reaction.

The number of protons present in the nucleus is the defining property of the chemical element. It is referred to as the atomic number, is represented by the symbol (Z). All the atoms which have the same atomic number are the atoms of same element. All of the matter present in the universe is composed of chemical elements.

Therefore, the correct option is D.

Learn more about Elements here:

https://brainly.com/question/13025901

#SPJ6

Answer:

The genotypic ratio shows the number of times a characteristic of an organism will be seen in the offspring when genes for certain traits are crossed.

Explanation: hope this helps :p

Answer:

image so we can answer the question?

Explanation:

Answer: Speed is the change in distance over time; velocity is speed plus direction.

Explanation:

While speed does not include direction, velocity does

For example: If I was traveling North at 5 mph,

The speed would be 5 mph

while the velocity would be 5 mph North

Answer:extreme temperature change

Explanation:

I took the quick check

Answer:

The species of wild rabbits that are brown would most likely have a harder time adapting than the white rabbits to the new environment.

Explanation: The brown rabbits are going to have a hard time living in the snow mostly because of their color. The brown rabbit is more likely to be able to live in the desert because they can camouflauge with their surroundings (the sand). Therefore, camouflaging in the white snow to escape a predator would be impossible for brown rabbits, since they could easily be spotted. Furthermore, the white rabbits would have a higher chance of survival since they can camouflage easier in the snow.

Answer: Function. Vitamin A helps form and maintain healthy teeth, skeletal and soft tissue, mucus membranes, and skin. It is also known as retinol because it produces the pigments in the retina of the eye. Vitamin A promotes good eyesight, especially in low light. Vitamin A (retinol) is ingested as either retinyl esters or carotenoids and metabolized to active compounds such as 11-cis-retinal, which is important for vision, and all-trans-retinoic acid, which is the primary mediator of biological actions of vitamin A

Explanation:

Answer:

stop codon

hope this helps, good luck :)

UAA is a codon that signals to stop making a protein, and so it is therefore called a stop codon.

Codon may be characterized as a sequence or collection of three consecutive nucleotides in a DNA or RNA molecule that significantly codes for a specific amino acid. These sequences of nucleotides give a signal to the start or end of translation.

A stop codon is also a sequence of three nucleotides (a trinucleotide) in DNA or messenger RNA (mRNA) that specifically signals a halt or inhibits to protein synthesis in the cell. Out of 64 different trinucleotide codons, there are only three stop codons are there, namely UAA, UAG, and UGA.

The start codon is the initial set of codons in an mRNA transcript that is translated by a ribosome. CAG is a start codon. Nonsense codons also play an important role.

Therefore, UAA is a codon that signals to stop making a protein, and so it is therefore called a stop codon.

To learn more about Stop codons, refer to the link:

https://brainly.com/question/6183177

#SPJ6

Answer:

A competitive firm’s marginal revenue always equals its average revenue and price. This is because the price remains constant over varying levels of output. In a monopoly, because the price changes as the quantity sold changes, marginal revenue diminishes with each additional unit and will always be equal to or less than average revenue. A conclusion is the last paragraph of your essay, or, if you’re writing a really long essay, you might need 2 or 3 paragraphs to conclude. A conclusion typically does one of two things—or, of course, it can do both: Summarizes the argument. Some instructors expect you not to say anything new in your Hydro-power is the energy harnessed from running water-streams, rivers or any other artificial or natural water flow. It is one of the oldest method of energy production. Even in the medieval period, people used to derive energy from water wheels. The contribution of hydel power in the world en­ergy production scenario is immense and ever-increasing.

Hydro-electricity now contributes nearly 7% of global electricity production when only 15.3 percent of the global exploitable hydro-electric potential is being used. Ever increasing awareness of ecology and social costs of hydro-plant construction failed to debar the increas­ing use of hydro-electricity.

Explanation:

Explanation:

this is just what is in my mind

Answer:

Introduction/Hook- Begin with a question based on the article. Give at least with three reasons of you position. Give your thesis.

Body- Explain three reasons of why is good or bad idea to invest in hydroelectric energy.

Provide evidence and explain it in each paragraph.

Conclusion- This the last chance to convince the reader to agree with your statement. Do not rewrite the reasons. You can restate your thesis.

If it is an argumented essay, provide the counterclaim (the other side opinion)and prove them that your statement is better.( this usually is the last paragraph of the body)

Explanation:

I'm not good at essays, but I know the basics.

I hopes this helps.

Answer:

Bacterial transformation is the transfer of free DNA released from a donor bacterium into the extracellular environment that results in assimilation and usually an expression of the newly acquired trait in a recipient bacterium

Explanation:

Answer:

Bacteria take DNA from their environment.

Explanation:

Bacterial transformation is a process of horizontal gene transfer by which some bacteria take up foreign genetic material (naked DNA) from the environment. ... The prerequisite for bacteria to undergo transformation is its ability to take up free, extracellular genetic material. Such bacteria are termed as competent cells