How do you write 7 square root x^5 in exponential form

How Do You Write 7 Square Root X^5 In Exponential Form

Answers

Answer 1

Given:

[tex]7(\sqrt[]{x})^5[/tex]

To find the exponential form:

[tex]\begin{gathered} 7(\sqrt[]{x})^5=7(x^{\frac{1}{2}})^5 \\ =7x^{\frac{5}{2}} \end{gathered}[/tex]

Hence, exponential form is,

[tex]7x^{\frac{5}{2}}[/tex]


Related Questions

Draw the dilation of PQRS using center Q and scale factor 1/2. Label the dilation TUWX. 2. Draw the dilation of PQRS with center R and scale factor 2. Label the dilation ABCD. 3. Show that TUWX and ABCD are similar.

Answers

Based on the given image, you obtain the following figures:

Draw the dilation of PQRS using center Q and scale factor 1/2

Draw the dilation of PQRS with center R and scale factor 2. Label the dilation ABCD

You can notice that both figure TUWX and ABCD are similar because the quotient between sides TU and PQ, XW and RS, UW and BC, TX and AD are the same.

For the function f(x) = x^2 + 3x,a) Find f(-2).b) Is this function linear or quadratic? Justify your answer.c) Will the graph of this function appear as a line or a parabola?

Answers

a) Evaluating the function at x= -2 we get:

[tex]f(-2)=(-2)^2+3(-2)=4-6=-2[/tex]

b) Notice that the given function has the form:

[tex]y=ax^2+bx+c[/tex]

Therefore f(x) is a quadratic function.

c) Since f(x) is a quadratic function its graph is a parabola.

Which of the following represents the equation of a quadratic curve?y = 3x + 7y = 8 - 3x + 7x2y = 7(3)xy = 8 x 6

Answers

An equation will be a quadratic curve when the expression has the following definition

[tex]y=ax^2+bx+c[/tex]

We can have b and c equal to 0, but never a, therefore we have few variations like

[tex]\begin{gathered} y=ax^2+bx \\ y=ax^2+c \\ y=ax^2 \end{gathered}[/tex]

All they are quadratics. Looking at the options we can see that the only function that has that definition is

[tex]y=8-3x+7x^2[/tex]

Therefore the correct answer is

[tex]y=8-3x+7x^{2}[/tex]

Given the diagram shown, which of the following statements are true.

Answers

I,II

1) Since in this diagram we have two triangles, whose sides AI and LH are parallel to each other we can state the following:

2) And since similar triangles have congruent angles and proportional sides, we can state as true the following:

I.∠JHL ≅ ∠JIK Similar triangles have congruent angles

As they are similar triangles we can write out the following ratios:

[tex]\frac{JI}{JH}=\frac{JK}{JL}[/tex]

These are true

And the third is not correct.

3) Hence, the answer is I,II

Solve 3x-9 = 6.A. x = 2B. x=-1C. x = 1D. x = 5

Answers

Step 1. The expression that we have is:

[tex]3x-9=6[/tex]

And we need to solve for x.

If we are going to solve for x, we need to have the 'x' alone on one side of the equation.

For that, the first step is to add 9 to both sides:

[tex]3x-9+9=6+9[/tex]

Step 2. On the left side, -9+9 cancel each other, and on the right side 6+9 is 15:

[tex]3x=15[/tex]

Step 3. The next step is to divide both sides by 3:

[tex]\frac{3x}{3}=\frac{15}{3}[/tex]

In this way, 3/3 on the left side cancel each other and we are left only with x:

[tex]x=\frac{15}{3}[/tex]

And on the right side, 15/3 is equal to 5:

[tex]\boxed{x=5}[/tex]

This is shown in option D.

Answer:

D. x=5

Write using an exponent: 1×7×7×7×7×7a. 1×7×5b.[tex]1 \times {7}^{5} [/tex]c. [tex]1 \times {5}^{7} [/tex]

Answers

In the expression, the number 7 is multiplied to itself 5 times or five 7's are multiplied with each other. So exponential expression for the equation is,

[tex]1\cdot7\cdot7\cdot7\cdot7\cdot7=1\cdot7^5[/tex]

Option B is correct.

Choose the expression that is equal to 28.3A. 3³+27.2-6.8+2⁴-3.1B. 3³+27.2-(6.8+2⁴-3.1)C. [3³+(27.2-6.8)]+2⁴-3.1D. 3³+27.2-(6.8+2⁴)-3.1

Answers

solution

For this case we can solve each case and we have:

A) 27 +27.2 -6.8 +16 -3.1= 60.3

B) 27 +27.2 -(6.8 +16 -3.1)= 54.2- 19.7= 34.5

C) 27 + 20.4 +16 -3.1= 30.1

D) 27 +27.2 - 22-8 -3.1= 28.3

then the correct solution for this case would be:

D)

How much work is done when a book weighting 2.0 new newtons is carried at a constant velocity from one classroom to another classroom 26 meters away.

Answers

[tex]\begin{gathered} F\cdot d=W \\ \text{ F is the force, d is distance, and w is the work} \\ 2\cdot26=W \\ \\ 52=W \\ \text{ thus the answer is 52} \end{gathered}[/tex]

5. Use the equation E =- my?my where E is kinetic energy, m is the mass of an object, and v is the object'svelocityLet E = 100, 000 J and v = 24 m/s. Find the object's mass.Show your work here:Choose the correct answer:173.6 kg86.8 kg8333.3 kg347.2 kg

Answers

In general, the kinetic energy is given by the formula below

[tex]E=\frac{1}{2}mv^2[/tex]

Where m is the mass and v is the speed of the object.

Therefore, in our case,

[tex]\begin{gathered} E=100000,v=24 \\ \Rightarrow100000=\frac{1}{2}m(24)^2 \end{gathered}[/tex]

Solve for m as shown below

[tex]\Rightarrow m=\frac{200000}{576}=347.2222\ldots[/tex]

Thus, the answer is 347.2 kg, approximately.

Question 7. Y=(5/2)^xSketch the graph of each of the exponential functions and label three points on each graph.

Answers

Given:

[tex]y=\mleft(\frac{5}{2}\mright)^x[/tex]

To sketch the graph:

First find the three points.

Put x=-1 we get,

[tex]\begin{gathered} y=(\frac{5}{2})^{-1} \\ =\frac{2}{5} \\ =0.4 \end{gathered}[/tex]

Put x=0 we get,

[tex]\begin{gathered} y=(\frac{5}{2})^0 \\ =1 \end{gathered}[/tex]

Put x=1 we get,

[tex]\begin{gathered} y=(\frac{5}{2})^1 \\ =2.5 \end{gathered}[/tex]

Therefore, the three points are, (-1, 0.4), (0, 1), and (1, 2.5).

The graph is,

find the range of the data set show in the table below

Answers

Remember that

the range is the spread of your data from the lowest to the highest

so

range=Maximum value-Minimum value

we have

Maximum value=170

Minimum value=27

Range=170-27=143

therefore

answer is

Range 143

Find the value of the test statistic z using z =P-Ppan37) A claim is made that the proportion of children who play sports is less than 0.5, and the sample statistics includen = 1158 subjects with 30% saying that they play a sport.Answer: - 13.6138) The claim is that the proportion of drowning deaths of children attributable to beaches is more than 0.25, andthe sample statistics include n = 647 drowning deaths of children with 30% of them attributable to beaches.Answer: 2.94

Answers

37. The given p-value is 0.5

Also the observed proportion is:

[tex]\hat{p}=30\%=0.3[/tex]

And q is (1-p), so:

[tex]q=1-0.5=0.5[/tex]

And the n-value is given 1158.

By replacing these values into the test statistic formula we obtain:

[tex]z=\frac{\hat{p}-p}{\sqrt[]{\frac{p\cdot q}{n}}}=\frac{0.3-0.5}{\sqrt[]{\frac{0.5\cdot0.5}{1158}}}=\frac{-0.2}{\sqrt[]{0.0002}}=\frac{-0.2}{0.015}=-13.61[/tex]

The answer is -13.61

Is (4,-3) a solution to the following system of equations?X - y = 42x + y = 5

Answers

Answer:

No, (4, -3) is not a solution to the system of equations

Explanation:

If (4, -3) is a solution to the given system of equations, then

for x = 4, and y = -3, both of the equations are satisfied.

x - y = 4 - (-3)

= 4 + 3

= 7

This is not 4, so the first equation is not satisfied

2x + y = 2(4) + (-3)

= 8 - 3

= 5

This equation is satisfied

It is sufficient to conclude that (4, -3) is not a solution to the system of equations since it doesn't satisfy the first equation

Ian is a salesperson who sells computers at an electronics store. He makes a base payof $80 each day and then is paid a $5 commission for every computer sale he makes.Make a table of values and then write an equation for P, in terms of x, representingIan's total pay on a day on which he sells x computers.

Answers

ANSWER

[tex]P=5x+80[/tex]

EXPLANATION

Let the number of computers sold be x.

Let the total pay be P.

We have to find the equation that represents the total pay in terms of the number of computers sold.

The equation that represents the total pay is a linear equation and a linear equation has a general form of:

[tex]y=mx+b[/tex]

where m = slope

b = y intercept

To find the slope, we have to apply the formula:

[tex]m=\frac{y_2-y_1}{x_2-x_1}[/tex]

where (x1, y1) and (x2, y2) are two sets of points from the table.

Let us pick (0, 80) and (3, 95)

Therefore, the slope, m, is:

[tex]\begin{gathered} m=\frac{95-80}{3-0} \\ m=\frac{15}{3} \\ m=5 \end{gathered}[/tex]

Now, we apply the point-slope formula to find the equation:

[tex]P-P_1=m(x-x_1)[/tex]

Note: P is used in place of y (the dependent variable)

Therefore, we have:

[tex]\begin{gathered} P-80=5(x-0) \\ P-80=5x \\ \Rightarrow P=5x+80 \end{gathered}[/tex]

That is the equation that represents the total pay, P.

Challenge The vertices of ABC are , , and . ABC is reflected across the y-axis and then reflected across the x-axis to produce the image A''B''C''. Graph and .

Answers

The graph shows triangle ABC with vertices as follows;

[tex]\begin{gathered} A=(-5,5) \\ B=(-2,4) \\ C=(-2,3) \end{gathered}[/tex]

When translated 6 units to the right, and 7 units down, its becomes,

[tex]\begin{gathered} A^{\prime}=(1,-2) \\ B^{\prime}=(4,-3) \\ C^{\prime}=(4,-4) \end{gathered}[/tex]

That means its reflected across the y-axis and the x-axis as follows;

[tex](x,y)\rightarrow(x+6,y-7)[/tex]

After this the translation is complete.

[in the following write an expression in terms of the given variables that represents the indicated quantity.]the sum of three consecutive integers if the greatest integer is x.the expression for the sum of the three consecutive integers is _________

Answers

Answer

Sum of the three consecutive integers = 3x - 3

Explanation:

Find the sum of three consecutive integers

Condition given: Greatest integer should be x

Since, x is the greatest integer, therefore, the other integers should be less than x

The three consecutive integers are: x, x - 1, and x - 2

Sum of the three integers = x + x - 1 + x - 2

Sum = x + x - 1 + x - 2

Collect the like terms

= x + x + x - 1 - 2

Sum = 3x - 3

Therefore, the sum of the three consecutive integers is 3x - 3

Find the value of x and y.

Answers

These 3 angles are equal value

5x + 1 = 6x - 10 = y

Then

5x + -6x = -10 - 1

-x = 11

x= 11

NOW find y value

y = 5x + 1

y= 6x - 10

y = 5•( 11) + 1= 56

y= 6•( 11) -10= 56

Answer is y= 56

find the mean the median the mode range and standard invitation of each data set that is obtained after adding the given content to each value (number 1)

Answers

Answers:

Mean = 43.7

Median = 44.5

Mode = doesn't exist

Standard deviation = 4.78

Explanation:

First, we need to add the constant to each value, so the new data is:

33 + 11 = 44

38 + 11 = 49

29 + 11 = 40

35 + 11 = 46

27 + 11 = 38

34 + 11 = 45

36 + 11 = 47

28 + 11 = 39

41 + 11 = 52

26 + 11 = 37

Now, we can organize the data from least to greatest as:

37 38 39 40 44 45 46 47 49 52

Then, the mean is the sum of all the numbers divided by 10, because there are 10 values in the data. So, the mean is:

[tex]\begin{gathered} \operatorname{mean}=\frac{37+38+39+40+44+45+46+47+49+52}{10} \\ \operatorname{mean}=43.7 \end{gathered}[/tex]

The median is the value that is located in the middle position of the organized data. Since there are 10 values, the values in the middle are the numbers 44 and 45, so the median can be calculated as:

[tex]\operatorname{median}=\frac{44+45}{2}=44.5[/tex]

The mode is the value that appears more times in the data. Since all the values appear just one time, the mode doesn't exist.

To calculate the standard deviation, we will calculate first the variance.

The variance is the sum of the squared difference between each value and the mean, and then we divided by the number of values. So, the variance is equal to:

[tex]\begin{gathered} (37-43.7)^2+(38-43.7)^2+(39-43.7)^2+(40-43.7)^2+ \\ (44-43.7)^2+(45-43.7)^2+(46-43.7)^2+(47-43.7)^2+ \\ (49-43.7)^2+(52-43.7)^2=228.1 \end{gathered}[/tex][tex]\text{Variance}=\frac{228.1}{10}=22.81[/tex]

Finally, the standard deviation is the square root of the variance, so the standard deviation is:

[tex]\text{standard deviation =}\sqrt[]{22.81}=4.78[/tex]

Find the domain of the rational function.f(x)=(x−7)/(x+8)

Answers

Answer:

[tex](-\infty,-8)\cup(-8,\infty)[/tex]

Explanation:

Given the rational function:

[tex]f(x)=\frac{x-7}{x+8}[/tex]

The domain of f(x) is the set of the values of x for which the function is defined.

A rational function is undefined when the denominator is 0.

Set the denominator of f(x) equal to 0 in order to find the value(s) of x at which f(x) is undefined.

[tex]\begin{gathered} x+8=0 \\ \implies x=-8 \end{gathered}[/tex]

-8 is the excluded value of the domain.

Therefore, the domain of f(x) is:

[tex](-\infty,-8)\cup(-8,\infty)[/tex]

4 The number of cars in 5 different parkinglots are listed below.35, 42, 63, 51, 74What is the mean absolute deviation ofthese listed numbers?

Answers

The number of cars in 5 different parking lots are given as data points as follows:

[tex]35\text{ , 42 , 63 , 51 , 74}[/tex]

We are to determine the Mean Absolute Deviation ( MAD ). It is a statistical indicator which is used to quantify the variability of data points. We will apply the procedure of determining the ( MAD ) for the given set of data points.

Step 1: Determine the Mean of the data set

We will first determine the mean value of the data points given to us i.e the mean number of cars in a parking lot. The mean is determined by the following formula:

[tex]\mu\text{ = }\sum ^5_{i\mathop=1}\frac{x_i}{N}[/tex]

Where,

[tex]\begin{gathered} \mu\colon\text{ Mean} \\ x_i\colon\text{ Number of cars in ith parking lot} \\ N\colon\text{ Total number of parking lots} \end{gathered}[/tex]

We will use the above formulation to determine the mean value of the data set:

[tex]\begin{gathered} \mu\text{ = }\frac{35\text{ + 42 + 63 + 51 + 74}}{5} \\ \mu\text{ = }\frac{265}{5} \\ \textcolor{#FF7968}{\mu=}\text{\textcolor{#FF7968}{ 53}} \end{gathered}[/tex]

Step 2: Determine the absolute deviation

The term absolute deviation is the difference of each point in the data set from the central tendency ( mean of the data ). We determined the mean in Step 1 for this purpose.

To determine the absolute deviation we will subtract each data point from the mean value calculated above.

[tex]AbsoluteDeviation=|x_i-\mu|[/tex]

We will apply the above formulation for each data point as follows:

[tex]\begin{gathered} |\text{ 35 - 53 | , | 42 - 53 | , | 63 - 53 | , | 51 - 53 | , | 74 - 53 |} \\ |\text{ -18 | , | -11 | , | 10 | , | -2 | , | }21\text{ |} \\ \textcolor{#FF7968}{18}\text{\textcolor{#FF7968}{ , 11 , 10 , 2 , 21}} \end{gathered}[/tex]

Step 3: Determine the mean of absolute deviation

The final step is determine the mean of absolute deviation of each data point calculated in step 2. Using the same formulation in Step 1 to determine mean we will determine the " Mean Absolute Deviation ( MAD ) " as follows:

[tex]\begin{gathered} \mu_{AD}\text{ = }\frac{18\text{ + 11 + 10 + 2 + 21}}{5} \\ \mu_{AD}\text{ = }\frac{62}{5} \\ \textcolor{#FF7968}{\mu_{AD}}\text{\textcolor{#FF7968}{ = 12.4}} \end{gathered}[/tex]

Answer:

[tex]\textcolor{#FF7968}{MAD=12.4}\text{\textcolor{#FF7968}{ }}[/tex]

Yoko, Austin, and Bob have a total of $57 in their wallets. Austin has $7 less than Yoko. Bob has 2 times what Yoko has. How much does each have?

Answers

Yoko has $16 money, Austin has $9 and Bob has $32.

According to the question,

We have the following information:

Yoko, Austin, and Bob have a total of $57 in their wallets. Austin has $7 less than Yoko. Bob has 2 times what Yoko has.

Now, let's take the money Yoko has to be $x.

So, we have the following expressions for the money Austin and Bob have:

Austin = $(x-7)

Bob = $(2x)

Now, we have the following expression by adding them:

x+x-7+2x = 57

4x-7 = 57

4x = 57+7

4x = 64

x = 64/4

x = $16

Now, the money Austin has:

16-7

$9

Money Bob has:

2*16

$32

Hence, Yoko has $16 money, Austin has $9 and Bob has $32.

To know more about money here

https://brainly.com/question/16524187

#SPJ1

A book store sells used books. Paperback books cost $1.00. Hardback books sell for $5.00. The store sold 100 books and made $260 from the sale, How many paperback books did the store sell?

Answers

ANSWER

60 paperback books

EXPLANATION

We have that:

Paperback books sell for $1.00

Hardback books sell for $5.00

The store sold 100 books and made $260.

Let the number of paperback books be x

Let the number of hardback books be y.

This means that:

x + y = 100 _____(1)

and

1 * x + 5 * y = 260

=> x + 5y = 260 ____(2)

We have two simultaneous equations:

x + y = 100 ____(1)

x + 5y = 260 ___(2)

From (1):

x = 100 - y

Put that in (2):

100 - y + 5y = 260

=> 100 + 4y = 260

Collect like terms:

4y = 260 - 100

4y = 160

y = 160 / 4

y = 40 books

This means that:

x = 100 - 40

x = 60 books

Therefore, 60 paperback books were sold.

The following data for a random sample of banks in two cities represent the ATM fees for using another bank's ATM. Compute the sample variance for ATM fees for each city.City A1.25 1.00 1.50 1.25 1.50City B2.50 1.25 1.00 0.00 2.00The variance for city Ais $(Round to the nearest cent as needed.)

Answers

City A (n = 5)

1.25 1.00 1.50 1.25 1.50

City B

2.50 1.25 1.00 0.00 2.00

The variance formula is:

So, the mean A is:

(1.25 + 1.00 + 1.50 + 1.25 + 1.50)/5 = 1.30

The variance for city A is:

s²_A = 0.04

For city B:

Mean B = 1.35

The variance for city B is:

s²_B = 0.92

which choice is equivalent to the quotient below? sqrt 7/8* sqrt7/187/16/121/23/47/12

Answers

We can apply the following properties of radicals:

[tex]\begin{gathered} \sqrt[n]{ab}=\sqrt[n]{a}\cdot\sqrt[n]{b}\Rightarrow\text{ Product property} \\ \sqrt[n]{\frac{a}{b}}=\frac{\sqrt[n]{a}}{\sqrt[n]{b}}\Rightarrow\text{ Quotient property} \end{gathered}[/tex]

Then, we have:

[tex]\begin{gathered} \text{ Apply the product property} \\ \sqrt[]{\frac{7}{8}}\cdot\sqrt[]{\frac{7}{18}}=\sqrt[]{\frac{7}{8}\cdot\frac{7}{18}} \\ \sqrt[]{\frac{7}{8}}\cdot\sqrt[]{\frac{7}{18}}=\sqrt[]{\frac{7\cdot7}{8\cdot18}} \\ \sqrt[]{\frac{7}{8}}\cdot\sqrt[]{\frac{7}{18}}=\sqrt[]{\frac{49}{144}} \\ \text{ Apply the quotient property} \\ \sqrt[]{\frac{7}{8}}\cdot\sqrt[]{\frac{7}{18}}=\frac{\sqrt[]{49}}{\sqrt[]{144}} \\ \sqrt[]{\frac{7}{8}}\cdot\sqrt[]{\frac{7}{18}}=\frac{7}{12} \end{gathered}[/tex]

Therefore, the choice that is equivalent to the given product is:

[tex]\frac{7}{12}[/tex]

What does the constant 1.6 reveal about the rate of change of the quantity?

Answers

The form of the exponential growth/decay function is

[tex]f(x)=a(1\pm r)^x[/tex]

a is the initial amount

r is the rate of growth/decay per x years

We use + with growth and - with decay

Since the given function is

[tex]f(t)=2700(1.6)^{7t}[/tex]

Where t is time per week

Compare the two functions

[tex]\begin{gathered} a=2700 \\ (1+r)=1.6 \\ x=7t \end{gathered}[/tex]

Since 1.6 is greater than 1, then

The function is growth

Equate 1.6 by (1 + r) to find r

[tex]\begin{gathered} 1+r=1.6 \\ \\ 1-1+r=1.6-1 \\ \\ r=0.6 \end{gathered}[/tex]

Change it to percent by multiplying it by 100%

[tex]\begin{gathered} r=0.6\times100\text{ \%} \\ \\ r=60\text{ \%} \end{gathered}[/tex]

Since x = 7t then the time is every 7 weeks

The answer is

The function is growing exponentially at a rate of 60% every 7 weeks

Given that sin A= -4 over 5 and angle A is in quadrant 3, what is the value of cos(2A)?

Answers

Solution:

Given;

[tex]\sin(A)=-\frac{4}{5}[/tex]

Then, the value of cosine x is;

[tex]\cos(A)=-\frac{3}{5}[/tex]

Because cosine and sine are negative on the third quadrant.

Then;

[tex]\begin{gathered} \cos(2A)=\cos^2(A)-\sin^2(A) \\ \\ \cos(2A)=(-\frac{3}{5})^2-(-\frac{4}{5})^2 \\ \\ \cos(2A)=\frac{9}{25}-\frac{16}{25} \\ \\ \cos(2A)=-\frac{7}{25} \end{gathered}[/tex]

The graph shows the number of cups of coffee Sherwin consumed in one day and the number of hours he slept that same night:A scatter plot is shown. Data points are located at 1 and 9, 3 and 5, 5 and 6, 4 and 4, 2 and 7, and 6 and 4. A line of best fit crosses the y-axis at 10 and passes through the point 6 and 4.How many hours will Sherwin most likely sleep if he consumes 9 cups of coffee? (4 points)1, because y = −x + 102, because y = −x + 109, because y = −x + 1010, because y = −x + 10

Answers

Given:

The two endpoints (1, 9) and (6, 4).

To find the number of hours will Sherwin most likely sleep if he consumes 9 cups of coffee:

Using the two-point formula,

[tex]\begin{gathered} \frac{y-y_1}{y_2-y_1}=\frac{x-x_1}{x_2-x_1} \\ \frac{y-9}{4-9}=\frac{x-1}{6-1} \\ \frac{y-9}{-5}=\frac{x-1}{5} \\ y-9=-x+1 \\ y=-x+10 \end{gathered}[/tex]

Substitute x=9 we get,

[tex]\begin{gathered} y=-9+10 \\ y=1 \end{gathered}[/tex]

Hence, the answer is,

[tex]1,because\text{ y=-x+10}[/tex]

I need to solve each system by graphing. so pls help! This is Algebra 1

Answers

Given the system of inequalities:

2x + 3y < -6

-2x + 3y < 6

Let's solve the system by graphing.

To graph, rewrite the inequalities in slope-intercept form:

y = mx + b

Inequality 1:'

Subtract 2x from both sides:

2x - 2x + 3y < -2x - 6

3y < -2x - 6

Divide all terms by 3:

[tex]\begin{gathered} \frac{3y}{3}<-\frac{2x}{3}-\frac{6}{3} \\ \\ y<-\frac{2}{3}x-2 \end{gathered}[/tex]

Inequality 2:

Add 2x to both sides:

-2x + 2x + 3y < 2x + 6

3y < 2x + 6

Divde all terms by 3:

[tex]\begin{gathered} \frac{3y}{3}<\frac{2x}{3}+\frac{6}{2} \\ \\ y<\frac{2}{3}x+2 \end{gathered}[/tex]

Now, let's plot 3 points from each inequlality and connect using a straight edge.

Inequality 1:

When x = -3

Substitute -3 for x and solve for y:

[tex]\begin{gathered} y<-\frac{2}{3}(-3)-2 \\ \\ y<2-2 \\ \\ y<0 \end{gathered}[/tex]

When x = 0:

[tex]\begin{gathered} y<-\frac{2}{3}(0)-2 \\ \\ y<-2 \end{gathered}[/tex]

When x = 3:

[tex]\begin{gathered} y<-\frac{2}{3}(3)-2 \\ \\ y<-2-2 \\ \\ y<-4 \end{gathered}[/tex]

From inequality 1, we have the points:

(x, y) ==> (-3, 0), (0, -2), (3, -4)

For inequlity 2:

When x = -3:

[tex]\begin{gathered} y<\frac{2}{3}(-3)+2 \\ \\ y<-2+2 \\ \\ y<0 \end{gathered}[/tex]

When x = 0:

[tex]undefined[/tex]

Which inequality is represented by the graph

Answers

The inequality 4x - 2y < 12 is represented by the attached graph. which is the answer would be an option (B).

What is inequality?

Inequality is defined as mathematical statements that have a minimum of two terms containing variables or numbers that are not equal.

As per option (B),

4x - 2y < 12

We can see that the x-intercept is (0, -6), and the y-intercept is (2.5, 0) in the given graph which is determined by substituting the value of x and y is equal to 0 in the equation 4x - 2y = 12.

The inequality 4x - 2y < 12 is represented by the attached graph.

Hence, the answer would be option (B).

Learn more about inequalities here:

brainly.com/question/20383699

#SPJ1

Suppose someone wants to accumulate $120,000 for retirement in 30 years. The person has two choices. Plan A is a single deposit into an account with annual compounding and an APR of 6%. Plan B is a single deposit into an account with continuous compounding and an APR of 5.8%. How much does the person need to deposit in each account in order to reach the goal?The person must deposit $______ into the account for Plan A to reach the goal of $.The person must deposit $______ into the account for Plan B to reach the goal of $.(Round to the nearest cent as needed.)

Answers

We want to calculate the amount needed as an initial investment to have 120000 after 30 years.

Recall that the formula of annual compounding is given by the formula

[tex]S\text{ =}P\text{ \lparen1+r\rparen}^t[/tex]

where P is the principal, r is the interest rate and t is the time in years. When compounded continously the formula is

[tex]S=Pe^{rt}[/tex]

where the variables have the same meaning. In both cases we want to find P sucht that

[tex]S=120000[/tex]

when t=30 and r is the interest rate that we are given.

So we have the following equation in the first case

[tex]120000=P\text{ \lparen1+}\frac{6}{100})^{30}[/tex]

so if we divide both sides by (1+6/100)^30 we get

[tex]P=\frac{120000}{(1+\frac{6}{100})^{30}}\approx20893.22[/tex]

so for Plan A 20893.22 is needed to have 120000 after 30 years.

now, we want to do the same with the second plan. We have

[tex]120000=Pe^{\frac{5.8}{100}30}[/tex]

so we divide both sides by exp(5.8*30/100). So we get

[tex]P=\frac{120000}{e^{\frac{5.8}{100}\cdot30}}\approx21062.45[/tex]

so for Plan B 21062.45 is needed to have 120000 after 30 years

Other Questions
MAH ~ WCF what is the value of x?picture will be sent in messages where can I find L1 and L4 ? for missing alternate angles 4p-9=2p+21solve the equation write an inequality for the graph using x for the variable. Evaluate the determinant.7 3 28 2 76 8 5A) 212B) -464 -212D860 How did the French respond when the United States refused to pay debts owed to France. Question 4Below is the CODING STRAND of a small gene that codes for a peptide. Assume the gene has atraditional start codon.How many amino acids long is the peptide if we assume traditional start and traditional stopcodon?5' AATCCGTATCTATGACCGTTTGGAAACACTAAGCGGTACTC 3'3569 Which equations represent a linear function? Select two. a. y = x-1 b. y = 4.5 C. 3x 4y = 2 d. 5x2 = 10y e. y = 1/2x2 +6 suppose s and t are mutually exclusive events. find p (s or t) if p(s)=29% and p(t)=49% There are a total of 50 questions worth 130 points on Chenille's history exam. Someof the questions are worth five points each, and the other questions are worth twopoints each. Which of the following systems of equations could be used todetermine F, the correct number of five point questions, and t, the correct numberof two point questions answered correctly? 4. __H2SO4 + __Cr(OH)3 --> __Cr2(SO4)3 + __H2OYou have 4 moles of H2SO4. How many moles of H2O are produced? Which of the following is equal to ? 1/5^-2 ) What is the most notable difference between particles in the solid phase and the liquid phase? Express the following as an algebraic function of x.sin(sin-'(x) cos-'(x)) Convert 15 gal to quarts List the structure and functions of the main organs of the United Nations Question 4 please . Using a graphing utility (geogebra) to graph the function Identify the units you would expect for the given quantity.The price of a bottle of French perfume, found by multiplyingthe unit price of the perfume in euros per milliliter by thevolume of the bottle in milliliters. I have that sweatshirt for 10 years Locate the incorrect words in the following paragraph and add them to the columns with correct words. ( Passage Incorrect Correct Ones there was a King who _______ ________ thought only to himself. ________ ________ He only talked about her own charms _______ ________ and conquests in a court all day. _______ ________ He wants people to believe his tales _______ ________ and talk about his greatness to everyone.