Han finds an expression for S(r) that gives the surface area in square inches of any cylindrical can with a specific fixed volume, in terms of its radius r in inches. This is the graph Han gets if he allows r to take on any value between -1 and 5.

What would be a more appropriate domain for Han to use instead?

What is this asking I don't understand

Answers

Answer 1

The more appropriate domain for Han is values between 0 and 4, while the minimum surface area is 20.

Given that,

Han discovers an equation for S(r) that, in terms of the radius r in inches, yields the surface area in square inches of any cylindrical container with a particular fixed volume. If Han lets r to take on any value between -1 and 5, he will obtain the graph shown above.

The more appropriate domain to use

The function's finishing graph is added as an attachment.

We can make the following observations based on the graph.

Minimum x value = 0

Maximum x value = 4

The following is a representation of the domain of the function's graph:

Minimum x value  <=  x <= Maximum x value

Substitute the known values in the above equation

So, we have

0 <= x <= 4

0 and 4 are represents a more appropriate domain.

The minimum surface area

The graph that completes the function is added as an attachment

From the graph, we have the following observation

Minimum y value = 20

20 is the minimum surface area of the cylindrical can.

Therefore, The more appropriate domain for Han is values between 0 and 4, while the minimum surface area is 20.

To learn more about domain visit: https://brainly.com/question/28135761

#SPJ1


Related Questions

A pack of cinnamon-scented pencils sells for $8.00. What is the sales tax rate if the total cost of the pencils Is $8.56 The sales tax rate is ___%

Answers

To find the tax rate we can use the rule of three.

[tex]\begin{gathered} 8\rightarrow100 \\ 8.56\rightarrow x \end{gathered}[/tex]

Then,

[tex]x=\frac{8.56\cdot100}{8}=107[/tex]

Now, since 8.56 dollars represents 107% of the prices, this means that the tax rate is 7.

3.152 written as an improper fraction or a mixed number and explained how it was done.

Answers

Answer: 3.152 as an improper fraction would be: 394 / 125

Step-by-step explanation: You can take any number, such as 3.152, and write a 1 as the denominator to make it a fraction and keep the same value, like this:

3.152 / 1

To get rid of the decimal point in the numerator, we count the numbers after the decimal in 3.152, and multiply the numerator and denominator by 10 if it is 1 number, 100 if it is 2 numbers, 1000 if it is 3 numbers, and so on.

Therefore, in this case we multiply the numerator and denominator by 1000 to get the following fraction:

3152 / 1000

Then, we need to divide the numerator and denominator by the greatest common divisor (GCD) to simplify the fraction.

The GCD of 3152 and 1000 is 8. When we divide the numerator and denominator by 8, we get the following:

394 / 125

(have a nice day)

If a = [tex]\frac{2 + \sqrt{5}}{2}[/tex], find the value of [tex]a^{2} + \frac{1}{a^{2} }[/tex].

Answers

The value of [tex]a^{2} +\frac{1}{a^{2} }[/tex] if  [tex]a=\frac{2+\sqrt{5} }{2}[/tex] is solved to be

5.1

How to determine the equation

The equation is solved by substituting for a in the given equation [tex]a^{2} +\frac{1}{a^{2} }[/tex]

[tex]a^{2} +\frac{1}{a^{2} }[/tex]

substituting for a

[tex](\frac{2+\sqrt{5} }{2})=(1+\frac{\sqrt{5} }{2})[/tex]

[tex](1+\frac{\sqrt{5} }{2})^{2} =(1+\frac{\sqrt{5} }{2})*(1+\frac{\sqrt{5} }{2})=1+2\frac{\sqrt{5} }{2} +\frac{5}{4}=\sqrt{5} +\frac{9}{4}=4.48607[/tex]

= 4.8607 + 1/4.48607

= 5.0664

Substituting the value of a in the equation and solving resulted to 5.1

Learn more on substitution at:

https://brainly.com/question/26094713

#SPJ1

Leah is buying titles for her bathroom. Each tile is 3/8 foot wide and covers an area that is 7/3 square feet. The bathroom floor is in the shape of a rectangle. She is putting 8 tiles along the longer wall of the bathroom and 5 tiles along the shorter wall of the bathroom. What is the perimeter of the bathroom? The bathroom and one tile are pictured below.

Answers

The perimeter of the rectangular floor is 103 feet.

What are rectangles?With four sides, four corners, and four right angles (90°), a rectangle is a closed 2-D object. A rectangle's opposing sides are equal and parallel.Since a rectangle is a two-dimensional form, it has two dimensions: length and width. The rectangle's length is its longer side, while its width is its shorter side.

So, the perimeter of the bathroom floor will be:

First, let the length of the tiles be 'x'.

Now,

7/3 = x × 3/8x = 7/3 ÷ 3/8x = 7/3 × 8/3x = 56/9

So, the length of the tile is 56/9.

Now, the l and b of the rectangular floor will be:

56/9 × 8 + 3/8 × 5448/9 + 15/88(448) + 9(15)/723584 + 135/723719/7251.65

Formula is: 2(l+b)

Now,

2 × 51.65103.3

Rounding off: 103 feet

Therefore, the perimeter of the rectangular floor is 103 feet.

Know more about rectangles here:

https://brainly.com/question/25292087

#SPJ1

octavia simplified the expression as shown explain octavia’s error and correct her work

Answers

To simplify

[tex](3x^9)^2(3x^2)^4[/tex]

First of all, Octavia error can be spotted from the correct steps below

Step1: Expand the expression

[tex]3^2\times x^{9\times2}\times3^4\times x^{2\times4}=3^2\times x^{18}\times3^4\times x^8[/tex]

Step2: Collect like terms

[tex]3^2\times3^4\times x^{18}\times x^8[/tex]

Step 3: Simplify by using exponents laws

[tex]3^{2+4}\times x^{18+8}=3^6\times x^{26}[/tex]

Step 4: Combine the terms.

The value is

[tex]729x^{26}[/tex]

Her error was that she didn't apply the exponents' law properly.

One of the laws she violated was

[tex](a^b)^c=a^{b\times c}[/tex]

Her mistake was that she did

[tex](a^b)^c=a^{b+c}\text{ which is wrong}[/tex]

So she missed it from our step 1 above

There are 83 skiers in line to ride the chair lift. If each chair seats 6 people, how many skiers will be on the last chair?

Answers

Answer:

4 people will be on the last chair.

Step-by-step explanation:

60 divided by 5 is 12. There will be 12 full seats. 64 - 60 is 4 so there will be 4 more on the last chair.  

Hope this helped!

-2/3 (x-7) = 1/6 (x+1) -3

Answers

Answer: x = 9

Step-by-step explanation:

   We will isolate the variable x to solve this equation.

   Given:

-2/3 (x-7) = 1/6 (x+1) -3

   Distribute:

-2/3x + 14/3 = 1/6 (x+1) -3

-2/3x + 14/3 = 1/6x + 1/6 -3

   Combine like terms on the right side using subtraction:

-2/3x + 14/3 = 1/6x - 17/6

   Subtract 1/6x from both sides of the equation:

-5/6x + 14/3 = - 17/6

   Subtract 14/3 from both sides of the equation:

-5/6x = -15/2

   Divide both sides of the equation by -5/6:

x = 9

12)50 students took a quiz with five questions. The frequency table below shows the results of the quiz. Use the frequency table to answer the following questions. ValueFrequencyRelative FrequencyCumulative Frequency040.084180.1612260.1218320.04204150.3355150.350a)How many students answered exactly 3 questions correctly?Number of students answered exactly three questions = 2b)How many students answered less than 3 questions correctly?c)What proportion (percent) of students answered exactly 4 questions correctly?

Answers

Explanation

From the table, we have:

• The first column (Value),: indicates the # of correct answers,

,

• The second column (Frequency),: indicates the # of students that answer the # of correct answers to the left in the table,

,

• The third column (Relative Frequency),: indicates the proportion of the # of students to the total,

,

• The fourth column (Cumulative Frequency),: gives the sum of the previous frequencies up to that row.

Using these data, we answer the questions:

a) Looking at the column Frequency for Value = 3, we find that 2 students answered exactly 3 answers correct.

b) Looking at the column Cumulative Frequency for Value = 2 (the previous value to 3), we find that 18 students answered less than 3 questions correctly.

c) Looking at the column Relative Frequency for Value = 4, we find that 0.3 = 0.3 * 100% = 30% of the students answered exactly 4 questions correctly.

Answer

a) 2

b) 18

c) 30%


b. A family of four went to see a live concert in Vancouver. Each family member bought
a commemorative concert T-shirt, which cost 1/5 of the price of a ticket. The total bill
for 4 tickets and 4 T-shirts was $384. How much did each ticket and each T-shirt cost?

Answers

The cost of 1 ticket is $80 and the cost of 1 T-Shirt is $16    .

In the question ,

it is given that ,

a family of four people went to see a live concert in Vancouver ,

and the price of T-shirt is 1/5 of the price of the ticket .

let the price of 1 ticket be = x ,

so , the price of 1 T-Shirt be = x/5 .

also given that the bill for 4 tickets and 4 T-Shirts was $384 ,

that means

4x + 4x/5 = 384

taking LCM as 20 and solving further ,

we get,

20x/5 + 4x/5 = 384

24x/5 = 384

24x = 384*5

24x = 1920

x = 1920/24

x = 80

the cost for T-Shirt = 80/5 = 16

Therefore , The cost of 1 ticket is $80 and the cost of 1 T-Shirt is $16    .

Learn more about Equations here

https://brainly.com/question/28219555

#SPJ1

Solve for a side in right triangles

Answers

The length of AC is 2.96 units using trigonometric ratio.

What are the trigonometric ratios?

Sine (sin), cosine (cos), tangent (tan), cotangent (cot), cosecant (cosec), and secant are the six trigonometric ratios. A branch of mathematics called trigonometry in geometry deals with the sides and angles of a right-angled triangle.

Given that angle A = 65° and AB = 7 units.

The base of △ABC is AC, height is BC, and hypotenuses is AB.

Cosine of angle is the ratio of base to hypotenuses.

Thus cos  65° = AC/AB

Substitute AB = 7

cos  65° = AC/7

Multiply both sides by 7:

7 × cos  65° = AC

Putting cos  65° = 0.42261826174

7 × 0.42261826174 =AC

AC = 2.95832783218

AC = 2.96 (nearest hundredth)

To learn more about right triangles, click on below link:

https://brainly.com/question/13324532

#SPJ1

Whats the Square root of 32 to the power of 5

Answers

Answer:

2^25/2

Step-by-step explanation:

We express them as a power of 2 using laws of indices

What is the solution to the missing side of the figure, rounded to the nearest tenths place?A) 16.2.B.) √261C) 16.1D.) 261

Answers

The figure appears to be a triangle with the following measures:

Opposite Side = a = 6

Adjacent Side = b = 15

Hypotenuse = c = unknown

To be able to find the measure of the unknown side, since it appears to be a right triangle, we will be using the Pythagorean Formula:

[tex]\text{ c}^2=a^2+b^2[/tex][tex]\text{ c = }\sqrt[]{a^2+b^2}[/tex][tex]\begin{gathered} \text{ c = }\sqrt[]{(6)^2_{}+(15)^2} \\ \end{gathered}[/tex][tex]\text{ = }\sqrt[]{36\text{ + 225}}[/tex][tex]\text{ = }\sqrt[]{261}[/tex][tex]\text{ c = }\sqrt[]{261}\text{ = 16.1554944214}[/tex]

The aspect ratio for a computer screenis 118. If the width of the computer screen is 13.5inches. What is the begi of the mean?Answer question 1 photo attached

Answers

The aspect ratio for a computer screen is

if the width equals 13.5, then the height is:

[tex]h=\frac{13.5}{1.8}=7.5[/tex]

Write an equation in slope-intercept form for the graph shown.

Answers

Answer:

y= 2x-3

Step-by-step explanation:

4/2 OR 2 is the slope

-3 is the intercept  

can someone help me with this assignment pls

Answers

The order pair (3, 14) is from the given scatter plot.

What is scatter plot?

Scatter plots are used to observe and plot relationships between two numeric variables graphically with the help of dots. The dots in a scatter plot shows the values of individual data points.

• A scatter plot with increasing values of both variables can be said to have a positive correlation.

• A scatter plot with an increasing value of one variable and a decreasing value for another variable can be said to have a negative correlation.

In the given scatter plot, the order pair with x-coordinate 3 is 14

So, the order pair is (3, 14)

Therefore, the order pair (3, 14) is from the given scatter plot.

To learn more about the scatter plot visit:

https://brainly.com/question/29231735.

#SPJ1

Which of the following terms is defined as a set of all points in a planethat are a given distance from a point?O CircleO Line segmentO RayO Parallel line

Answers

Given:

A set of all points in a plane that are a given distance from a point.

Required:

To choose the correct option for the given definition.

Explanation:

A circle is the set of all points in a plane that are equidistant from a given point called the center of the circle.

Final Answer:

A set of all points in a plane that are a given distance from a point is called circle.

A restaurant offers a 20% off coupon. The tax rate is 7.5% . If an item is listed at $15 , how much does it cost after the coupon and tax have been applied?

Answers

Answer:

11.10 or 11.1

Step-by-step explanation:

1. 15 x 0.075= 1.125 or 1.13

2. 15-1.13=13.87

3. 13.87 x 0.20= 2.774 or 2.77

4. 13.87 -  2.77 = 11.10 or 11.1

84 points + brainliest if well explained and correct:
During a thunderstorm at a sports event, a detector goes off to let participants know there is lightning in the area so people can seek shelter. The accuracy of the lightning detector is summarized in the table.


Lightning detector activates Lightning detector does not activate Row Totals
Lightning in area 88% 2% 90%
No lightning in area 7% 3% 10%
Column Totals 95% 5% 100%


What is the ratio of false positives to false negatives in this scenario? Round your answer to one decimal place.
0.1
1.5
2.3
3.5

Answers

The ratio of false positives to false negatives is (d) 3.5

How to determine the ratio?

The table of values is given as

                          Activates.   Does not activate Row Totals

Lightning in area     88%           2%                           90%

No lightning in area 7%             3%                           10%

Column Totals           95%          5%                          100%

The false negative is when there is lighting and it does not activate

So, we have

False negative = 2%

The false positive is when  there is no lighting and it activates

So, we have

False positive = 7%

When represented as ratio, we have

Ratio = 7% : 2%

So, we have

Ratio = 7 : 2

This gives

Ratio = 7/2

Evaluate

Ratio = 3.5

Hence, the ratio is (d) 3.5

Read more about ratio at

https://brainly.com/question/2784798

#SPJ1

14 in 8 in 5 in 7 in 9 in 15 in

Answers

To find the area of the whole figure, we can divide it into two rectangles, the smaller rectangle has dimensions of 5 inches by 8 inches.

[tex]A_{small}=5in\times8in=40in^2[/tex]

The bigger rectangle has dimensions of 9 inches by 15 inches.

[tex]A_{bigger}=9in\times15in=135in^2[/tex]

Then, we add

[tex]A=40+135=175in^2[/tex]Hence, the area of the figure is 175 square inches.

14. You buy a package that contains 10 1/2 cups of fruit and nut mix. How many snack bags each with 3/4 cup of fruit and nut mix can you fill from the package?

Answers

Given:

The package contains 10 1/2 cups of fruit and nut mix

When need to snack bags, each bag contain 3/4 cup

So, to find the number of bags, divide 10 1/2 by 3/4

so, the number of bags =

[tex]10\frac{1}{2}\div\frac{3}{4}=\frac{21}{2}\div\frac{3}{4}=\frac{21}{2}\cdot\frac{4}{3}=7\cdot2=14[/tex]

So, the answer is: the number of bags = 14

I NEED HELP! ASAP! WILL GIVE 50 POINTS!

Answers

Answer:

Of 20,000 people that apply, 6300 actually enroll.

Step-by-step explanation:

70% of 20,000 is 14,000

45% of 14,000 is 6,300

what is the answer to 8.34x0.5

Answers

[tex]\begin{gathered} \Rightarrow8.34\times0.5 \\ \Rightarrow\frac{8.34}{2}=4.17 \end{gathered}[/tex]

Write the equation of the line in fully simplified slope-intercept form.
pls helpp me

Answers

Answer:

y= 1/5x -7

Step-by-step explanation:

1/5 is the slope

-7 is the y-intercept

The measures of two complementary angles are described by the expressions (11x−11)° and (16x−7)°. Find the measures of the angles.I know complementary when their measures add to 90 degrees. but I'm not to sure where to plug the numbers in

Answers

Given:

[tex](11x-11)^{\circ}and(16x-7)^{\circ}\text{ forms an complementary angles.}[/tex][tex]\begin{gathered} 11x-11+16x-7=90 \\ 27x-18=90 \\ 27x=90+18 \\ 27x=108 \\ x=\frac{108}{27} \\ x=4 \end{gathered}[/tex]

Which situation could be represented by the graph

Answers

Answer:

what graph

Step-by-step explanation:

It is one question the three images are the options for answers to the question.

Answers

[tex]\begin{gathered} Algebra\text{ is based on following rules and procedures} \\ Solutions\text{ problems can be justified in various ways} \\ Procedures\text{ must be followed in a precise order} \end{gathered}[/tex]

The number of infected
zombies triples every
hour. How many
zombies are there after 6
hours if one zombie was
initially infected?

Answers

Answer:

f(x) = 4(1.15)6.

Step-by-step explanation:

Got It? Do these problems to find out.
b. y = x-5


c. y = -2x


pls help, thanks!

Answers

Answer:

For b, you just start at (0,-5)(go down 5 on the y-axis), and go one up, one over to the right, and for c, just start at (0,0) and go right one, up 2

Step-by-step explanation:

What is the value of x?

Answers

Answer:

75 degree

Step-by-step explanation:

We know that a straight angle is 180 degree

and in the picture we can see an angle of 105 degree

so we get 180-105= 75 degree

The difference of a number and 6 is the same as 5 times the sum of the number and 2. What is the number?A 4B. -2C -1D. 1

Answers

You need to know the following:

1. The "difference" is the result of a subtraction.

2. The word "times" indicates a multiplication.

3. The sum is the result of an addition.

Let be "n" the number mentioned in the exercise.

Knowing the explained above, you know that "the difference of a number and 6" can expressed as:

[tex]n-6[/tex]

And "5 times the sum of the number and 2" can be expressed as:

[tex]5(n+2)[/tex]

Therefore, "the difference of a number and 6 is the same as 5 times the sum of the number and 2" can be written as the following equation:

[tex]n-6=5(n+2)[/tex]

Now, in order to find the number, you must solve for "n":

[tex]undefined[/tex]

Other Questions
Which of the following notations correctly describe the end behavior of the polynomial graph below? Write an inequality for the word problem and answer the question about the inequality. Eric has an equal number of dimes and quarters that total less than 4 dollars. Could he have 12 dimes The question is in the picture. Using the answer choice word bank, fill in the proportion to find the volume of the larger figure. Why is the population of the Manufacturing Belt shrinking while the population of the Sunbelt is growing? The restriction enzyme EcoR1 recognizes the DNA sequence GAATTC. Which DNA strands will be cut byEcoR1?i. TTCAGGAATTCGGAAACCAAGTCCTTAAGCCTTTGGii. TGAATCGAACCTGACTTAGCTTGGACiii. TTAAGCGGCCGAATTCAGTCCAAATTCGCCCGCTTAAGTCAGGTiv. CAGTAGGATTTCTGTGTCGTCATCCTAAAGACACAG 30 POINTS PLS HELPBecause it is so popular, a store owner increases the cost of a toy by $4.99. The new cost of the toy is $14.84. (a)Write an equation that represents the situation. Use c to represent the original cost of the toy. (b)Solve the equation using a related equation. Show your work.(c)What does the solution of the equation represent? Can someone help me on this Im confused According to the phase diagram for HO, what happens to the phases ofwater at 0.5 atm pressure as the temperature is decreased from 110C to -10C?A) water changes from a gas to a solid to a liquidB) Water changes from a solid to a liquid to a gasC) water changes from a liquid to a gas to a solidD) water changes from a gas to a liquid to a solid Gimme answer please graph the function, not by plotting points, but by starting from the graph of y=e^x in the figure below.the function is: y= e^-x -1?? I need help finding the asymptote?? The neutrons within the nucleus of an atom have what charge?Question 15 options:negativesame as an electronsame as a protonno charge Thesis statement on earthquakes 7/10 3/10 solve complex fraction The circumference of a circle is 24 in. What is the area, in square inches? Express your answer in terms of . Point O is the center of this circle. What is m can someone help me with this assignment The number of calories burnes by a 90-pound cyclist is proportional to the numer of hours the cyclist rides. the equation to represent this relationship is Y=225. What is the constant of proportionality? During the majority of the process of repolarization, the cardiac cell is unable to respond to a new electrical stimulus; the cardiac cell cannot spontaneously depolarize, and this period is referred to as the How can I draw a histogram to illustrate the information? How do I calculate the median age of the population? Two number cubes are rolled what is the probability that the sum of the numbers rolled is either a 1 and a 4 in either order