Abiotic: the sunlight and water.
Biotic: Plants and insects
Explanation:
Plants such as cactuses can absorb and conserve water in their roots and use the sunlight to grow taller
Insects such as Desert beetles can trap moisture in their thick exoskeletons so they are parched or burned by the sun. They sometimes bury themselves deep in the sand where it's cooler.
The abiotic factors in the desert help the biotic factors survive
Platinum is a catalyst humans use in fuel cell. Although for green energy humans use some bacteria that releases enzymes such as hydrogenase to perform functions as platinum in fuel cell. This is an example of
a. Biofilm
b. Biosensing
c. Biomimicry
Answer:
B
Explanation:
90% of people marry there 7th grade love. since u have read this, u will be told good news tonight. if u don't pass this on nine comments your worst week starts now this isn't fake. apparently if u copy and paste this on ten comments in the next ten minutes you will have the best day of your life tomorrow. you will either get kissed or asked out in the next 53 minutes someone will say i love u
Why is earth considered an open system and a closed system? (Site 1)
O
Answer:
Open system: has the transfer and exchange of matter and energy in the system's surroundings.
Closed system: has a limit to how much matter is exchanged.
All of Earth's systems are considered open systems, but as a whole, they are closed.
Explanation:
1. If a long tail is a dominant characteristic, in which case is the characteristic of a long tail definitely expressed?
A) when at least one allele contains instructions for a long tail
B) when at least one parent has a long tail
C) when both alleles contain instructions for a long tail
D) when both parents have a long tail
2. What is true of all body cells except sex cells?
A) Each cell type carries chromosomes and genes that identify it as that specific type of cell. For example, skin cells have different chromosomes and genes than muscle cells.
B) Each body cell contains the same number and kinds of chromosomes for that organism. The chromosomes contain the same number and kinds of genes for that individual.
C) While each cell type in the body contains the same kinds of genes, they are organized on different chromosomes depending on the cell type.
D) While each cell in the body contains the same number of chromosomes, each cell type has different genes along those chromosomes.
Answer:
1. A) when at least one allele contains instructions for a long tail
2. B) Each body cell contains the same number and kinds of chromosomes for that organism. The chromosomes contain the same number and kinds of genes for that individual.
Answer:
A. when at least one allele contains instructions for a long tail
Explanation:
The guy above me Answered. oh yeah, also have a cheeseburger while your at it. lol
state two features of diffusion that do no apply to active transport
The total number of chromosomes in an organism is referred to as the
Will mark brainliest
Answer:
ploidy
Explanation:
Ploidy is the number of complete sets of chromosomes in a cell, and hence the number of possible alleles for autosomal and pseudoautosomal genes.
Which RNA molecule is matched with its correct function?
Answer:
Which class of RNA is correctly paired with its function? Transfer RNA (tRNA): attaches to an amino acid. What is the difference between the template strand and the nontemplate strand? The template strand is the DNA strand that is transcribed into an RNA molecule, whereas the nontemplate strand is not transcribed
Offer a possible explanation why even identical twins are not exactly alike.
Answer:
Because identical twins are an example of sexual reproduction, which provides different looking offspring
Explanation:
Organisms that are birthed of asexual reproduction are always exactly identical
HELP!!!
Part.2
This is science.
Answer:
snuflower (common) = Queen anne' s lace
they enjoy being alone and quiet for a small-time what are they?
Answer:
Introverts enjoy being alone because of acetylcholine) this chemical in the brain might induce a kind of happy feeling, for the introvert.
A type of tissue called _______ tissue is responsible for communicating between the brain and the rest of the body
Answer:
Nervous tissue is responsible for communicating between the brain and the rest of the body
Answer:
A nerve/nervous tissue
Explanation:
12. Which of the methods of generating electricity does NOT use alternative energy
resources?
a. Burning coal in a power plant
b. Turbines spinning in dam
c. Solar panels taking in light energy
d. Drilling wells to reach hot rocks deep inside the earth
Answer:
i think its A. burning coal in a power plant
Explanation:
sorry if im wrong but please let me know if this is correct or not
The method of generating electricity that does not use alternative energy resources is burning coal in a power plant.
What are alternative energy resources?Alternative energy resources are eco-friendly resources that can be used to produce energy.
These are renewable resources and can not be extinct.
These resources do not pollute the earth.
Examples are windmills, solar panels, hydropower, etc.
Thus, the correct option is a. Burn coal in a power plant.
Learn more about energy resources
https://brainly.com/question/11193460
For a type of pea plant, round seeds (R) are dominant to wrinkled seeds (r). A pea plant
with the genotype Rr is crossed with another pea plant with the genotype Rr. What
percent of the offspring are expected to have wrinkled seeds?
O 100%
O 75%
O 50%
O 25%
Which is required for a bacterial cell to replicate its DNA?
a. tRNA
b. DNA polymerase
c. Rna stand with an origin of replication
Answer:
c
Explanation:
90% of people marry there 7th grade love. since u have read this, u will be told good news tonight. if u don't pass this on nine comments your worst week starts now this isn't fake. apparently if u copy and paste this on ten comments in the next ten minutes you will have the best day of your life tomorrow. you will either get kissed or asked out in the next 53 minutes someone will say i love u
how does the process of translation convert information from a dna code to an rna code?
a. from a DNA code to an RNA code
b. from an amino acids code to a nucleic acid code
c. from an RNA code to a DNA code
d. from a nucleic acid code to an amino acid code
Answer:B
Explanation:
The nitrogen bases in DNA code for the sequence of amino acids that make up a protein
Answer:
its B
Explanation:
By which process do plants try to avoid
self-pollination?
A. The plant dies to avoid this.
B. The plant detaches the male part of the plant from
itself.
C. They attract pollinators.
D. They have no control over this process of self-
pollination.
Answer:
it's C. They attract pollinators
The stems of bamboo, a tropical grass, can grow at the phenomenal rate of 0.3 m/day under optimal conditions. Given that the stems are composed almost entirely of cellulose fibers oriented in the direction of growth, calculate the number of sugar residues per second that must be added enzymatically to growing cellulose chains to account for the growth rate. Each D-glucose unit contributes ~0.5 nm to the length of a cellulose molecule.
Answer:
Approximately 6944 glucose residues are added enzymatically per second
Explanation:
Cellulose is the main structural polysaccharides in plants. It is composed of unbranched glucose monomer units linked to each other by beta 1-4 glycosidic bonds.
The cell wall and stem of plants cells are composed of cellulose fibers. They provide rigidity and support to the plant.
In the given bamboo plant, the enzymatic addition of glucose units to the growing cellulose fiber chains results in the phenomenal growth rate of the bamboo stem.
Since each glucose unit contributes ~0.5 nm to the length of a cellulose molecule, number of glucose units required for daily growth is calculated as follows:
0.5 nm = 10⁻⁹
0.3 m/0.5 x 10⁻⁹ m = 600000000 units of glucose per day
Number of seconds in a day = 24 * 60 * 60 = 86400 seconds
Number of glucose residues added per second = 600000000/86400
Number of glucose residues added per second = 6944.4 glucose molecules per second
Therefore, approximately 6944 glucose residues are added per second
The average molecular weight of proteins encoded in the human genome is about 50,000. A few proteins are very much larger than this average. For example, the protein called titin, which is made by muscle cells, has a molecular weight of 3,000,000. Estimate how long it will take a muscle cell to translate an mRNA coding for an average protein and one coding for titin. The average molecular mass of amino acids is about 110 daltons. Assume that the translation rate is two amino acids per second.
Answer:
13,636 seconds = 227.3 minutes = 3.79 hours
Explanation:
The titin protein has a molecular weight of 3,000,000 daltons, while the average molecular mass of one amino acid is 110 daltons, so it is expected that this protein is composed of 27,273 amino acids (3,000,000 daltons/110 daltons = 27,272.72). Moreover, and since the translation rate is two amino acids per sec, it is expected that the protein will be synthesized in approximately 3.79 hours (27,272.72/2 = 13,636 seconds = 227.3 minutes = 3.79 hours).
In a process called transpiration, plants get rid of excess water through pores in the leaves called stomata. This excess water is then released into the atmosphere as part of the water cycle. Which of the following terms best describes how the released water enters the atmosphere?
Group of answer choices
precipitation
condensation
capillary action
evaporation
Answer:
Evaporation
Explanation:
which of the following is an example of the current impact DNA technology has on human health?
Answer:plants grow
Explanation:te she said so
DeShawn wants to conduct a scientific study on how land-clearing in his city may have affected the quality of the water. Which source of information would be most valuable to his research? A. a survey given to the people of the city ten years ago on the possible effects of land-clearing on water B. the opinion of a neighbor who has some knowledge on how to test city water for impurities C. a recent city government report with data regarding how clean the water supply is D. a recent political article stating that the water of the city should be filtered and cleaned Reset Next Question
Answer: i think that the answer is C
Explanation:
The source of the information that should be most valuable to the research should be option C.
What is research?
It means that the development of the new knowledge should be done or there is the usage of the existing knowledge for generating the new conceptsm methods, and understanding. It involved the synthesis and the analysis of last research for resulting the new or the creative outcomes.
So based on this, the option c should be correct.
Learn more about research here: https://brainly.com/question/24108869
Please Help!
Who would be best qualified to consult on a case requiring forensic entomology?
A. A person with a Master's Degree in Entomology and less than a year's experience in Forensic Entomology.
B. A person with a Doctor's Degree and Membership in a Professional Society of Forensic Entomology.
C. A person with a Bachelor's in Entomology, but no experience in Forensic Entomology.
D. A person with a Doctorial Degree in Entomology and a Certificate in Forensic Entomology.
D. A person with a Doctoral Degree in Entomology and a Certificate in Forensic Entomology.
They will know the most about forensic entomology compared to the rest of the options.
A person with a Doctorial Degree in Entomology and a Certificate in Forensic Entomology. Hence option D is correct.
What is Entomology ?Entomology is defined as the investigation of insects and how they interact with people, the environment, and other living things. Entomology is employed extensively in a wide range of fields, including evolutionary biology and medical research, in addition to studying the anatomy and physiology of insects. It aids agricultural entomologists in their research on biodiversity as well as in the protection of priceless resources from insect pests.
Forensic entomology is defined as the study of arthropods, particularly insects, connected to criminal activity and other judicial issues. An essential tool in the examination of homicide, self harm, and other violent crimes is forensic entomology. When properly gathered and examined by skilled forensic investigators, insect evidence found on a victim's corpse can provide important information.
Thus, a person with a Doctorial Degree in Entomology and a Certificate in Forensic Entomology. Hence option D is correct.
To learn more about Entomology, refer to the link below:
https://brainly.com/question/2929449
#SPJ2
(NO LINKS PLEASE I REALLY NEED HELP)
Earth has gone through many cycles of ice ages followed by periods of warmer climate. How might these cycles be related to patterns of solar output and patterns of change in Earth’s motion in space?
Answer:
They both go back and forth, such as the climate going from hot to warm, and the tectonic plates of the earth going from closed 300 million years ago to spreading far apart now.
Both of them oscillate, as seen by the earth's tectonic plates, which went from being tightly packed 300 million years ago to spreading widely at the moment.
What is tectonic plate?Tectonic plate is defined as the lithosphere is made up of sections or parts of the upper mantle and crust of the earth. Starting around 4 billion years ago, cooler parts of the Earth's crust were forced downward into the warmer upper mantle, damaging and weakening the surrounding crust. According to the authors, this cycle repeated itself until the weak spots established plate borders.
Slow variations in the Earth's orbit start and conclude these ice eras. However, variations in CO2 concentrations in the atmosphere also play a significant role in driving both cooling at the start of ice ages and warming at their end. During the last ice age, the average global temperature was around 4C lower than it is now.
Thus, both of them oscillate, as seen by the earth's tectonic plates, which went from being tightly packed 300 million years ago to spreading widely at the moment.
To learn more about tectonic plates, refer to the link below:
https://brainly.com/question/19317822
#SPJ2
What genome rule does any prokaryotic life on earth commonly does not have?
a. small circular plasmid DNA
b. follows the central dogma DNA>RNA>proteins
c. has thymine in place of uracil on the RNA strand
HELPPPP!!!
this is science!
List the four powers of the president
Answer: The Constitution explicitly assigns the president the power to sign or veto legislation, command the armed forces, ask for the written opinion of their Cabinet, convene or adjourn Congress, grant reprieves and pardons, and receive ambassadors.
Explanation:
4. Calculate the kinetic energy of a Hollywood star running from the paparazzi. The star's mass is 45.0 kg, and the star is running at
a velocity of 3.00 m/s.
a) 203 J
b) 303.75 J
c) 405 J
d) 67.5 J
Answer:
i do not know
Explanation:
Answer:
A
Explanation:
=122
Assume that one backbone of a DNA molecule has the sequence given below. A-T-G-G-G-G-G-C-G-A-T-A-T-T-T-T-A-T-C-C-G-A-C-G For this sequence: give the expected sequence of the other DNA backbone. T-A-C-C-C-C-C-G-C-T-A-T-A-A-A-A-T-A-G-G-C-T-G-C give the RNA sequence transcribed from the original DNA backbone. U-A-C-C-C-C-C-G-C-U-A-T-A-A-A-A-U-A-G-G-C-U-G-C give the Amino Acid sequence of the protein built from the original DNA backbone.
Answer:
DNA: ATGGGGGCGATATTTTATCCGACG
RNA: AUGGGGGCGAUAUUUUAUCCGACG
Protein: MGAIFYPT
Explanation:
Transcription is a genetic process by which the information in a strand of DNA is copied into RNA, typically a messenger RNA (mRNA) sequence which is subsequently used to create a protein by the process of translation. During translation, each triplet of nucleotides or 'codon' corresponds to a specific amino acid. For example, AUG is a codon that codes for methionine (M) and also acts as an initiation codon at the beginning of the nascent polypeptide chain.
the children prepared a juice drink for their food festival by dissolving powdered juice in water what kind of mixture did they form? a. colloid b. suspension c. solution d. saturated solution
Please Help!!!!
Muscles intended for large, powerful contractions contain llx muscle fibers. true or false
Answer:
True
Explanation:
Been learning and know
Using the information in this photo, what can MOST LIKELY be learned about the rocks in the illustration?
A)
relative age
B)
absolute age
C)
melting point
D)
average rainfall
Answer:a
Explanation: got it right on usates