Calculator 5 ft С A window in the shape of a parallelogram has the dimensions given What is the area of this window?A.20 ftB.24 ftC.28 ftD.40 ft

Answers

Answer 1

Area of a parallelogram = b x h


Related Questions

I need help seeing how this works out because what I am doing is not right

Answers

We will have the following:

AB and CD related in terms of x and y will be:

[tex]\begin{gathered} AB=CD\Rightarrow x+y=2x-y-2 \\ \\ \Rightarrow2y=x-2\Rightarrow y=\frac{x}{2}-1 \end{gathered}[/tex]

So, the equation that relates AB and CD is:

[tex]y=\frac{x}{2}-1[/tex]

BC and DA in terms of x and y is:

[tex]\begin{gathered} BC=DA\Rightarrow x+2y=3x-3y+2 \\ \\ \Rightarrow5y=2x+2\Rightarrow y=\frac{2}{5}x+\frac{2}{5} \end{gathered}[/tex]

So, the equation that relates BC and DA is:

[tex]y=\frac{2}{5}x+\frac{2}{5}[/tex]

Now; we determine the values of x & y as follows:

[tex]\begin{gathered} \frac{x}{2}-1=\frac{2}{5}x+\frac{2}{5}\Rightarrow\frac{1}{10}x=\frac{7}{5} \\ \\ \Rightarrow x=14 \end{gathered}[/tex]

Then:

[tex]y=\frac{(14)}{2}-1\Rightarrow y=6[/tex]

So, the values are:

[tex]\begin{gathered} x=14 \\ \\ y=6 \end{gathered}[/tex]

One-sixth of the fourth graders and one-third of the fifth graders miss school on Friday. The absentee sheet for Friday shows the names of 9 fourth graders and 16 fifth graders. How many fourth and fifth graders are enrolled in the school?

Answers

Answer:

There are 54 4th graders.

There are 48 5th graders.

Step-by-step explanation:

1/6 of the 4th graders is 9 students.

1/6 x = 9

x = 9 × 6

x = 54

There are 54 4th graders.

1/3 of the 5th graders is 16 students.

1/3 x = 16

x = 3 × 16

x = 48

There are 48 5th graders.

There are 54 Fourth grader and 48 Fifth graders were enrolled in the school.

What is Algebra?

A branch of mathematics known as algebra deals with symbols and the mathematical operations performed on them.

Variables are the name given to these symbols because they lack set values.

In order to determine the values, these symbols are also subjected to various addition, subtraction, multiplication, and division arithmetic operations.

Given:

let the number of fourth graders be x.

and, let the number of fifth graders be y.

As, One-sixth of the fourth graders is 9.

and, one-third of the fifth graders is 16.

Then, 1/6 x = 9

x= 54

and, 1/3 y= 16

y= 48

Hence, there are 54 Fourth grader and 48 Fifth graders were enrolled in the school.

Learn more about Algebra here:

https://brainly.com/question/24875240

#SPJ2

how much popcorn would each person get if two shared a half a bag of popcorn equally

Answers

Half bag = 1/2 bag

Number of persons = 2

Then divide

(1/2 bag)÷2 = 1/4 bag

Each person will have 1/4 of a bag

Show fraction 15/4 on a number line

Answers

Given data:

The given number is a=15/4.

The given number can be written as,

[tex]\begin{gathered} a=\frac{15}{4} \\ =3.75 \end{gathered}[/tex]

The numberr can be expression on the number line between 3 and 4 but it is more close to 4.

xy12364468710 a. Construct a scatterplot. b. Is there a linear association, nonlinear association, or no association? c. Compute r. d. On the basis of the scatterplot and r, determine the strength of the association? Explain.

Answers

SOLUTION:

(a) From the given table, we are to construct a scatterplot.

(b) There is a strong linear association because all the points align themselves in a near perfect straight line.

(c) To Compute r;

(d) We are to determine the strength of the association;

Because r = 0.9934 which is very close to 1.0, so we conclude that the strength of the association is very strong.

Set up and solve a proportion for the following application problem. If 6 pounds of grass seed cover 366 square feet, how many pounds are neededfor 4392 square feet?am 24/7onlinepounds

Answers

We know that 6 pounds cover 366 square feet, then we have the ratio:

[tex]\frac{6}{366}[/tex]

Let x be the amount we need to cover 4392 square feet, then we have the ratio:

[tex]\frac{x}{4392}[/tex]

Since the ratios have to be equal we have the proportion:

[tex]\frac{x}{4392}=\frac{6}{366}[/tex]

Solving for x we have:

[tex]\begin{gathered} \frac{x}{4392}=\frac{6}{366} \\ x=4392\cdot\frac{6}{366} \\ x=72 \end{gathered}[/tex]

Therefore, 72 pounds are nedded for 4392 sq ft.

A ball is dropped from a height of 18 feet.The function f(x) = 18(0.75)* gives theheight in feet of each bounce, where x isthe bounce number. What will be theheight of the third bounce to the nearesttenth of a foot?

Answers

The height of the third bounce to the nearest tenth of a foot is 7.6 ft

Explanation:

The given function:

[tex]f(x)\text{ = }18\mleft(0.75\mright)^x[/tex]

f(x) = height in feet of each bounce

x represent the bounce number

For the third bounce, x = 3

replacing x with 3:

[tex]\begin{gathered} f(x)=18(0.75)^3 \\ f(x)\text{ = 18(0.4219)} \end{gathered}[/tex][tex]\begin{gathered} f(x)\text{ = }7.5942 \\ To\text{ the nearest tenth of foot = 7.6 ft} \end{gathered}[/tex]

The height of the third bounce to the nearest tenth of a foot is 7.6 ft

solve quadratic by completing the squarex^2 + 12x + 23 = 0which form do i use and solve(x+___)^2(x - ___) ^2solutionx = ___

Answers

Quadratics are in the general form:

[tex]ax^2+bx+c[/tex]

For completing the square, we use:

[tex](x+\frac{b}{2})^2=c+(\frac{b}{2})^2[/tex]

Now, we have:

[tex]\begin{gathered} (x+\frac{12}{2})^2=-23+(\frac{12}{2})^2 \\ (x+6)^2=-23+(6)^2 \\ (x+6)^2=13 \end{gathered}[/tex]

From here, we can easily solve for x with a little algebra. Shown below:

[tex]\begin{gathered} \sqrt[]{(x+6)^2}=\pm\sqrt[]{13} \\ x+6=\pm\sqrt[]{13} \\ x=-6\pm\sqrt[]{13} \end{gathered}[/tex]

The answer(s) are:

[tex]\begin{gathered} x=-6+\sqrt[]{13} \\ x=-6-\sqrt[]{13} \end{gathered}[/tex]

For further clarification

Form:

[tex](x+\frac{12}{2})^2=13[/tex]

How many significant figures will there be in answer to the following problem?6.783 - 2.56 =

Answers

We need to make the substraction:

[tex]6.783-2.56[/tex]

We do that as follows:

The number of significant figures in how many numbers we have in the answer, in this case the answer has 4 numbers, thus it has 4 significant figures.

The question: A box is a right rectangular prism with the dimensions 8 inches by 8 inches by 14 inches. What is the surface area of this box?

Answers

Given the length (l), the width (w), and the height (h) of the rectangular prism:

[tex]\begin{gathered} l=8in \\ w=8in \\ h=14in \end{gathered}[/tex]

You need to use this formula for calculating the surface area of a rectangular prism, in order to find the surface area of the box:

[tex]SA=2wl+2hl+2hw[/tex]

Where "l" is the length, "w" is the width, and "h" is the height of the rectangular prism.

Therefore, when you substitute the values into the formula and evaluate, you get:

[tex]\begin{gathered} SA=(2)(8in)(8in)+(2)(14in)(8in)+(2)(14in)(8in) \\ \\ SA=128in^2+224in^2+224in^2 \end{gathered}[/tex][tex]SA=576in^2[/tex]

Hence, the answer is:

[tex]SA=576in^2[/tex]

Answer:c 565

Step-by-step explanation:

Vanessa cycled from her home to the beach at a speed of 18 meters per second The distance between her home and the beach is 1,350 m. How long did she ta to cycle from her home to the beach? speed + distance=time​

Answers

Vanessa took 75 sec time to cycle from her home to the beach

What is Speed?

Speed is the time rate at which an object is moving along a path

Speed =Distance/time

Given,

Vanessa cycled from her home to the beach at a speed of 18 meters per second

Speed=18 m/s

The distance between her home and the beach is 1,350 m.

Distance=1,350 m

Now we need to find the time for Vanessa to cycle from her home to the beach

Time=?

We have formula of speed

speed=Distance/time

Time=Distance/speed

Time=1350/18

=75 sec

Hence Vanessa took 75 sec to cycle from her home to the beach

To learn more on Speed click:

https://brainly.com/question/28224010

#SPJ1

Points that lie on the same line are called:A. non-collinear and non-coplanarB. opposite raysC. coplanar and non-collinearD. collinear and coplanar

Answers

Points that lie on the same line

When two points lie on the same line are called collinear. When they lie on the same plane they are called coplanar.

Points that lie on the same plane are not necessarily collinear.

When points are collinear, they lie on the same plane. Then when points are collinear they are necessarily coplanar. But when they are coplanar they are not necessarily colinear.

This means that points that lie on the same line are collinear and coplanar too.

ANSWER: D

Three Turtles are racing . Abe the turtle's distance is represented by the green line, Benji the turtle's distance is represented by the red line, and Carter the turtle's distance is represented by the bule line. Use the graph to answer the following questions.

Answers

Using the graph we can see that Benji (the red line) goes 50 feet far, also by looking at the graph we see tht Carter (the blue line) takes 240 seconds to travel 80 feet.

If they are racing I would pick the one who takes less time to travel more distance, by the graph we see that Carter is faster than Benji and Abe.

Find the equation in slope-intercept form of the line passing through the points with the given coordinates.(5,2), (5,6)

Answers

Given,

The line is passing through the points (5,2), (5,6).

The standard equation of line passing through two points is,

[tex]y-y_1=\frac{y_2-y_1}{x_2-x_1}(x-x_1)[/tex]

Substituting the values of coordinates then,

[tex]\begin{gathered} y-2_{}=\frac{6_{}-2_{}}{5_{}-5_{}}(x-5) \\ y-2=\frac{4_{}}{0_{}} \\ y-2=\infty\mleft(x-5\mright) \\ \frac{y-2}{\infty}=x-5 \\ 0=x-5 \\ x=5 \end{gathered}[/tex]

Hence, the equation of line passing through point (5,2) and (5,6) is x=5.

Question 3 of 10
Which of the following is equal to 7%?
O A. 17
OB. 17.3
O C. 73
OD. 17

Answers

Since the exponent of 7 is 1/3, when this is converted to radical expression, the denominator of the exponent becomes the root of the radical. Hence,

[tex]7^{\frac{1}{3}}\Leftrightarrow\sqrt[3]{7}[/tex]

Therefore, 7^1/3 is equivalent to the cube root of 7. (Option A)

Solve the equation. 1 / 3X - 9 = -12

Answers

x=-9

Explanation

[tex]\frac{1}{3}x-9=-12[/tex]

Step 1

add 9 in both sides

[tex]\begin{gathered} \frac{1}{3}x-9=-12 \\ \frac{1}{3}x-9+9=-12+9 \\ \frac{1}{3}x=-3 \end{gathered}[/tex]

Step 2

multiply both sides by 3

[tex]\begin{gathered} \frac{1}{3}x=-3 \\ \frac{1}{3}x\cdot3=-3\cdot3 \\ x=-9 \end{gathered}[/tex]

I hope this helps you

Answer:

x=-9

Step-by-step explanation:

Solve for X by simplifying both sides of the equation, then isolating the variable. So, pretty much the other dude is right.

How to find the value of x so that the function has a given value

Answers

we have the function

f(x)=6x

f(x)=-24

substitute the given value of f(x)

-24=6x

solve for x

divide both sides by 6

-24/6=6x/6

simplify

-4=x

rewrite

x=-4

I need help on this problem getting the answers do you know what they are ??????????

Answers

• 16.

Common difeference:

Is the difference between consecutive numbers in an arithematic sequence

18 -20 = -2

16-18 = -2

14-16 = -2

Common difference = -2

• 17.

Explicit rule: Use the arithematic sequence formula

an = a1 +(n-1 ) d

Where:

a1 = first term = 20

d= common difference = -2

Replacing:

an = 20 + (n-1)-2

• 18.

Replace n by 11

an = 20 + (11-1 ) -2

an = 20 + (10)-2

an= 20 - 20

an = 0

Amount to be paid = 0 (zero)

a tunnel is in the shape of a parabola. The maximum height is 48 and it is 18 m wide at the base. What is the vertical clearance 3 m from the edge of the tunnel?

Answers

The vertical clearance 3 m from the edge of the tunnel at 19.1 m.

What is referred as the parabola?A parabola is just a U-shaped plane curve in which any point is an equal distance from both a fixed point (recognized as the focus) and a fixed straight line (known as the directrix).

For the parabola's maximum height is 50 m, its formula is of the form.

y = ax² + 48

The vertex is located at in this equation (0,48).

Is for vertex to be the maximum of y, the constant a must be negative.

The parabola's base is 18 m wide.

As a result, the x-intercepts seem to be (9,0) and (-9,0).

Set x = 9 and y=0 to obtain

a(9²) + 48 = 0

81a = -48

a = -0.59

The equation of the parabola is

y = - 0.59x² + 48

At 21.32 m of the  edge of the tunnel, x = 9 - 2 = 7 m.

Thus, the height of the tunnel (vertical clearance) at x =  7 m is

h = y(7)

  = -0.59(7²) + 48

h = 19.09

h = 19.1 m

Thus, the vertical clearance 3 m from the edge of the tunnel at 19.1 m.

To know more about the parabola, here

https://brainly.com/question/13009188

#SPJ1

as shown above a classic deck of card is made up of 52 cards suppose one card is selected at random and calculate the following probability

Answers

Given a classic deck of cards made up of 52 cards

Made up of 13 spades, hearts, diamonds and clubs each,

The formula of Probabaility is given below as,

[tex]\text{Probabilty}=\frac{\operatorname{Re}quired\text{ outcome}}{Possible\text{ outcome}}[/tex]

Where the Possible outcome = 52

The probability that a 6 of diamonds is selected is,

[tex]\begin{gathered} \text{required outcome = 1} \\ \text{Probability of a 6 of diamonds=}\frac{1}{52} \end{gathered}[/tex]

Probability that a 6 of diamonds is selected is 1/52

The probability that a heart or a diamond is selected,

[tex]\begin{gathered} Probabilty\text{ of a heart P}(H)\text{=}\frac{13}{52} \\ \text{Probability of a diamond=}\frac{13}{52} \\ \text{Probability of a heart or a diamond=}\frac{13}{52}+\frac{13}{52}=\frac{1}{4}+\frac{1}{4}=\frac{1}{2} \end{gathered}[/tex]

Probability that a heart or a diamond is selected is 1/2

Probability that a number smaller than 4 (counting the ace as 1) is selected is,

[tex]\begin{gathered} \text{Probability of picking a ace=}\frac{4}{52} \\ \text{Probability of picking a 2=}\frac{4}{52} \\ \text{Probability of picking a 3=}\frac{4}{52} \\ \text{Probability of picking a number smaller than 4=}\frac{4}{52}+\frac{4}{52}+\frac{4}{52}=\frac{3}{13} \end{gathered}[/tex]

Probability that a number smaller than 4 (counting the ace as 1) is selected is 3/13

Gillian works from 23 to 33 hours per week during the summer. She earns $12.50 per hour. Her friendEmily also has a job. Her pay for t hours each given is given by the function e(t) = 13t, where 18 st 3 28.Find the domain and range of each function. Then compare their hourly wages and the amount they earnper week.

Answers

The domain for g(t) is [23,33]

The domain for e(t) is [18,28]

The range for g(t) is [287.5,412.5]

The range for e(t) is [234,364]

How many square feet are there in 288 square inches (1 foot=12 inches)

Answers

Given:

1 foot = 12 inches

So, 288 square inches are:

[tex]288\text{ in}^2=288\text{ in}^2\times(\frac{1\text{ ft}}{12\text{ in}})^2[/tex]

Solve:

[tex]288\text{ in}^2\times\frac{1^2\text{ ft}^2}{12^2\text{ in}^2}=288\text{ in}^2\times\frac{1\text{ ft}^2}{144\text{ in}^2}[/tex]

Simplify:

[tex]2\text{ ft}^2[/tex]

Answer: 2 square feet

Mai has proven that triangle WYZ is congruent to triangle WYX using the Side-Side-Side Triangle Congruence Theorem. Why can she now conclude that diagonal W

Answers

Mai can conclude that "XWYZ will be the rhombus when we connect WYZ and WYX as all the sides are equal. In a rhombus, the opposing sides are parallel. In a rhombus, the opposing angles are equal. Diagonals in a rhombus cut each other at right angles. A rhombus' angles are divided by diagonals."

What is rhombus?

A quadrilateral with equal-length sides is a rhombus. The angles at the opposite vertex are equal, and the opposite sides are parallel. In a rhombus, the opposing sides are parallel. In a rhombus, the opposing angles are equal. Diagonals in a rhombus cut each other at right angles. A rhombus' angles are divided by diagonals.

What is diagonal?

A diagonal in mathematics is a line that joins two solids or polygons whose vertices are not on the same edge. Generally speaking, a diagonal is a sloping or slanting line that joins the vertices of a shape. The term "diagonal" refers to lateral shapes with sides, edges, and corners. A diagonal is a line segment that joins two opposing polygonal vertices (or corners). In other words, a diagonal is a line segment that joins two polygonal vertices that are not adjacent to one another. It connects a polygon's vertices, excluding the figure's edges.

To know more about rhombus,

https://brainly.com/question/27870968?referrer=searchResults

#SPJ1

If the x intercept of a line is positive and the y intercept is negative does the line slant upward or downward?

Answers

ANSWER:

slant upward

STEP-BY-STEP EXPLANATION:

The line would slant upward to the right because if the y-intercept is negative, the line starts below the x-axis and if the x-intercept is positive, it means the line continues from below the x-axis and crosses to the right. right. from the origin (to the right of 0), which means that it is tilted up to the right.

We can rectify it in the following graph

Corresponding Angles are congruent.Which angle corresponds with « 2?756 4.36.268 21152414.14 [?]A

Answers

Corresponding angles are a pair of equal angles that are found in the same relative positions of the intersection of a transversal and a pair of parallel lines.

Based on this definition, <2 is corresponding/congruent with <6

In the same vein, <3 = <7, <8 = <4, <5 = <1.

Sam and Sophia participates in a dice game. Sophia rolls one die. She gets $2 if 5 turns up. She gets $3 if 6 turns up. She loses $10 if 2 turns up. She neither wins nor loses if any other face turns up. Is this game fair?The game is not fair and not favorable to player.The game is not fair, but favorable to player.The game is fair.The game is fair, but not favorable to player.

Answers

Hello there. To solve this question, we need to analyze the probabilities for each case and see if the game is fair or not and also favorable to the player.

Sophia rolls a dice. If 5 turns up, she gets $2; If 6 turns up, she gets $3; If 2 turns up, she loses $10; She neither wins nor loses if any other face turns up.

First, let's remember something that will be important: a dice only haves 6 faces.

As we can see, she is winning (getting money) if 2 out of 6 faces turns up (5 and 6), and is losing if 1 out of 6 faces turns up (2). She is neither winning or losing if 3 out of 6 faces turns up (1, 3, 4).

About the fairness of the game, there are only 1 case she loses and 2 cases she wins something. We could only say the game is fair if the amount of winning cases were equal to the amount of losing cases. The game is not fair.

About being favorable, we'll consider it being unfavorable just the case that she loses money. The first and third cases, in which she gets money or doesn't get or lose money are favorable to her.

Since only 1 out of 6 faces makes her lose, then the game is favorable to the player.

Final answer: The game is not fair, but favorable to the player.

can you please solve this practice problem for me I need assistance C. -1/2 and D. 1/2

Answers

Slope of a lineStep 1: selecting two points of the graph

We are going to select the points when x = 0 and x = 2.

Observing the graph we see that when x = 0, then y = 1 - (0,1)

when x = 2, then y = 2 - (2, 2)

Now we have two points:

(x₁, y₁) = (0, 1)

(x₂, y₂) = (2, 2)

Step 2: change of variables

We are going to find how much the variables change from point 1 to point 2

Change of x:

Δx = x₂ - x₁ = 2 - 0 = 2

Δx = 2

Change of y:

Δy = y₂ - y₁ = 2 - 1 = 1

Δy = 1

Step 3: slope

The slope, m, is the division of the two found changes:

m = Δy/Δx = 1/2

Answer: D. 1/2

What is the mode of the following numbers?8, 1, 2, 6, 1, 4

Answers

[tex]\begin{gathered} \text{Ordering the numbers} \\ 1,1,2,4,6,8 \\ The\text{ mode is the number that has more frequency. In this case the mode is 1} \end{gathered}[/tex]

Need help with this question please!

Answers

Answer: the picture

Step-by-step explanation:

helpppppppppppppppppppp
Ben needs to graph the function f(x)=3(0.1)x. He creates a table of values, using integer values for x.

What does Ben's graph look like?

Drag a value or word to the boxes to correctly complete the statements.

Put responses in the correct input to answer the question. Select a response, navigate to the desired input and insert the response.
Responses can be selected and inserted using the space bar, enter key, left mouse button or touchpad.
Responses can also be moved by dragging with a mouse.
Ben's graph passes through the ordered pairs (−1,Response area), (0, Response area), and (2,Response area). The graph Response area left to right.

Answers

Answer:

is there a pitcher that comes with it ?

Step-by-step explanation:

Other Questions
A gas occupies 12.3 L at a pressure of 40 mmHg. What is the volume when the pressure is increases to 60 mmHg? Which of the following notations correctly describe the end behavior of the polynomial graph below? Write an inequality for the word problem and answer the question about the inequality. Eric has an equal number of dimes and quarters that total less than 4 dollars. Could he have 12 dimes The question is in the picture. Using the answer choice word bank, fill in the proportion to find the volume of the larger figure. Why is the population of the Manufacturing Belt shrinking while the population of the Sunbelt is growing? The restriction enzyme EcoR1 recognizes the DNA sequence GAATTC. Which DNA strands will be cut byEcoR1?i. TTCAGGAATTCGGAAACCAAGTCCTTAAGCCTTTGGii. TGAATCGAACCTGACTTAGCTTGGACiii. TTAAGCGGCCGAATTCAGTCCAAATTCGCCCGCTTAAGTCAGGTiv. CAGTAGGATTTCTGTGTCGTCATCCTAAAGACACAG 30 POINTS PLS HELPBecause it is so popular, a store owner increases the cost of a toy by $4.99. The new cost of the toy is $14.84. (a)Write an equation that represents the situation. Use c to represent the original cost of the toy. (b)Solve the equation using a related equation. Show your work.(c)What does the solution of the equation represent? Can someone help me on this Im confused According to the phase diagram for HO, what happens to the phases ofwater at 0.5 atm pressure as the temperature is decreased from 110C to -10C?A) water changes from a gas to a solid to a liquidB) Water changes from a solid to a liquid to a gasC) water changes from a liquid to a gas to a solidD) water changes from a gas to a liquid to a solid Gimme answer please graph the function, not by plotting points, but by starting from the graph of y=e^x in the figure below.the function is: y= e^-x -1?? I need help finding the asymptote?? The neutrons within the nucleus of an atom have what charge?Question 15 options:negativesame as an electronsame as a protonno charge Thesis statement on earthquakes 7/10 3/10 solve complex fraction The circumference of a circle is 24 in. What is the area, in square inches? Express your answer in terms of . Point O is the center of this circle. What is m can someone help me with this assignment The number of calories burnes by a 90-pound cyclist is proportional to the numer of hours the cyclist rides. the equation to represent this relationship is Y=225. What is the constant of proportionality? During the majority of the process of repolarization, the cardiac cell is unable to respond to a new electrical stimulus; the cardiac cell cannot spontaneously depolarize, and this period is referred to as the How can I draw a histogram to illustrate the information? How do I calculate the median age of the population?