After how many cakes will their savings be the same for both? b) What will their savings be?

After How Many Cakes Will Their Savings Be The Same For Both?b) What Will Their Savings Be?

Answers

Answer 1

Let "s" represent the amount saved in the bank account and "c" the number of cakes sold.

Jane (J)

Has a starting balance of $70 and she sells "c" cakes for $25 each, you can symbolize the earnings of the cake sales as 25c

You can express the total amount saved using the following expression

[tex]s_J=70+25c[/tex]

Miriam (M)

Has a starting balance of $100 and shells cakes for $20 each, you can symbolize the total earnings for her cakes sales as 20c

So the total amount saved can be expressed as:

[tex]s_M=100+20c[/tex]

a) To determine how many cakes they must sell so that their savings will be the same, you have to equal both expressions and calculate the value of c:

[tex]\begin{gathered} s_J=s_M \\ 70+25c=100+20c \end{gathered}[/tex]

To calculate for c, the first step is to pass the term containing the variable to the left by applying the opposite operation to both sides of the equal sign:

[tex]\begin{gathered} 70+25c-20c=100+20c-20c \\ 70+5c=100 \end{gathered}[/tex]

Repeat the process to pass 70 to the right side of the expression

[tex]\begin{gathered} 70-70+5c=100-70 \\ 5c=30 \end{gathered}[/tex]

And divide both sides by 5 to reach the value of c

[tex]\begin{gathered} \frac{5c}{5}=\frac{30}{5} \\ c=6 \end{gathered}[/tex]

After selling 6 cakes both Jae and Miriam will have saved the same amount.

b)

To determine what will their savings be, you have to replace either one of the expressions with c=6 and calculate for s:

[tex]\begin{gathered} s_J=70+25c \\ s_j=70+25\cdot6 \\ s_j=220 \end{gathered}[/tex]

If you solve it using Miriam's expression the result must be the same:

[tex]\begin{gathered} s_M=100+20c \\ s_M=100+20\cdot6 \\ s_M=220 \end{gathered}[/tex]

As you see using either equation we arrived to the same result, after selling 6 cakes their total saves will be $220


Related Questions

Need help finding the x-intercepts for equation in picture. I can see them on the graph but I need to work it out by solving.

Answers

Answer:

The x-intercepts of the function are;

[tex]\begin{gathered} x=-2 \\ \text{and} \\ x=-4 \end{gathered}[/tex]

Explanation:

Given the function;

[tex]f(x)=-2(x+3)^2+2[/tex]

We want to derive the x-intercepts of the function.

The x-intercept is at f(x)=0;

[tex]\begin{gathered} f(x)=-2(x+3)^2+2=0 \\ -2(x+3)^2+2=0 \\ -2(x^2+6x+9)^{}+2=0 \\ -2x^2-12x-18^{}+2=0 \\ -2x^2-12x-16=0 \\ -x^2-6x-8=0 \\ x^2+6x+8=0 \end{gathered}[/tex]

solving for x;

[tex]\begin{gathered} x^2+6x+8=0 \\ x^2+2x+4x+8=0 \\ (x+2)(x+4)=0 \\ x+2=0 \\ x=-2 \\ \text{and} \\ x+4=0 \\ x=-4 \end{gathered}[/tex]

Therefore, the x-intercepts of the function are;

[tex]\begin{gathered} x=-2 \\ \text{and} \\ x=-4 \end{gathered}[/tex]

Method 2: quadratic root property;

[tex]\begin{gathered} f(x)=-2(x+3)^2+2=0 \\ -2(x+3)^2+2=0 \\ -2(x+3)^2=-2 \\ \text{divide both sides by -2;} \\ (x+3)^2=1 \\ \text{square root both sides;} \\ \sqrt{(x+3)^2}=\sqrt{1} \\ x+3=\pm1 \\ x=-3\pm1 \\ so\text{ the values of x are;} \\ x=-3+1=-2 \\ \text{and} \\ x=-3-1=-4 \end{gathered}[/tex]

Therefore, the x-intercepts are;

[tex]\begin{gathered} x=-2 \\ \text{and } \\ x=-4 \end{gathered}[/tex]

I need help with this. I want to understand 7a first

Answers

Answer:

The exact length of segment XY is √4765 and the approximate length is 69.029

Explanation:

The length of a segment that goes from (x1, y1) to (x2, y2) can be calculated as

[tex]\sqrt{(x_2-x_1)^2+(y_2-y_1)^2}[/tex]

So, replacing (x1, y1) by X(-32, 88) and (x2, y2) by Y(11, 34), we get:

[tex]\begin{gathered} \sqrt{(11-(-32))^2+(34-88)^2} \\ \sqrt{(11+32)^2+(-54)^2} \\ \sqrt{43^2+(-54)^2} \\ \sqrt{1849+2916} \\ \sqrt{4765} \\ 69.029 \end{gathered}[/tex]

Therefore, the exact length of segment XY is √4765 and the approximate length is 69.029

(calc) which graph shows a function and its inverse ?

Answers

Answer: We have to pick a graph that represents a function and its inverse function, or:

[tex]\begin{gathered} f(x)\rightarrow\text{ and }\rightarrow f^{-1}(x) \\ \end{gathered}[/tex]

The inverse function switches the x and y variables, therefore the axes with it, the final result is two functions that are symmetrical about y = x line.

Example:

[tex]\begin{gathered} f(x)=\sqrt{x}\rightarrow\text{ Function} \\ \\ f^{-1}(x)=x^2\rightarrow\text{ Inverse Function} \end{gathered}[/tex]

Graph:

Therefore the graph out of the options which has these properties is:

[tex]\text{ Graph\lparen C\rparen}[/tex]

The answer, therefore, is Graph(C).

(x + y)² – 3zz when X = -2, y = -4, and z = 5.

Answers

-39

Explanation

[tex]\begin{gathered} \mleft(x+y\mright)^2-3zz \\ \end{gathered}[/tex]

Step 1

let

x=-2

y=-4

z=5

Step 2

Now, replace those values in the expression

[tex]\begin{gathered} (x+y)^2-3zz \\ (-2+(-4))^2-3\cdot5\cdot5 \\ (-2-4)^2-75 \\ (-6)^2-75 \\ 36-75 \\ -39 \end{gathered}[/tex]

I hope this helps you

Choose the correct answer. 1. Shari made a net of a box to find how much wrapping paper she will need to . wrap the box 8 in. 5 in.

Answers

The total area needed to be covered is 158 square inch.

It is calculated by adding all the area

[tex]2\ast(8\ast5)+\text{ 2}\ast(5\ast3)+2\ast(8\ast3)=158in^2\text{ }[/tex]

The scatterplot shows the average number of hours each of 13 people spends at work every week and the average number of hours each of them spends recreational activities every week.Based on the scatterplot,what is the best prediction of the average number of hours a person spends at work every week if that person spends an average of 10 hours on recreational activities every week?A.33 hB.95 hC.50 hD.65 h

Answers

We want to find the best prediction of the average number of hours a person spends at work every week if that person spends an average of 10 hours on recreational activities every week.

We will construct a line that adapts to the system by simple linear regression, and then we will find the x-value that makes the line take y=10.

First, we have the data:

We remember that in a simple regression model, we want to write an equation of the form:

[tex]y=\hat{\alpha}+\hat{\beta}x[/tex]

where:

[tex]\begin{gathered} \hat{\alpha}=\bar{y}-\hat{\beta}\bar{x} \\ \hat{\beta}=\frac{nS_{xy}-S_xS_y}{nS_{xx}-S^2_x}_{} \end{gathered}[/tex]

And the Sx, Sy and Sxx are the sums over all the x-values, the y-values and the multiplication of the x-values and y-values (respectively).

We will find those values:

[tex]\begin{gathered} S_x=\sum ^{13}_{i=1}x_i=370 \\ S_y=\sum ^{13}_{i=1}y_i=336.5 \end{gathered}[/tex]

Also, we have:

[tex]\begin{gathered} S_{xx}=\sum ^{13}_{i=1}x^2_i=12600 \\ S_{xy}=\sum ^{13}_{i=1}x_iy_i=8680_{}_{} \end{gathered}[/tex]

And applying the formula, having in mind that n=13, we get:

[tex]\begin{gathered} \hat{\beta}=\frac{nS_{xy}-S_xS_y}{nS_{xx}-S^2_x}_{} \\ =\frac{13(8680)-(370)(336.5)}{13(12600)-(370^2)} \\ =\frac{-11665}{26900} \\ \approx-0.4336 \end{gathered}[/tex]

And, for alpha:

[tex]\begin{gathered} \hat{\alpha}=\frac{1}{n}S_y-\hat{\beta}\frac{1}{n}S_x \\ =\frac{1}{13}(336.5)-(-0.4336)\frac{1}{13}(370) \\ \approx38.2255 \end{gathered}[/tex]

This means that the linear regression equation will be:

[tex]y=38.2255-0.4336x[/tex]

For finding the x-value that will have 10 hours of recreational activities, we replace the 10 value on y, and clear out the variable x:

[tex]10=38.2255-0.4336x[/tex]

And thus,

[tex]\begin{gathered} 10-38.2255=-0.4336x \\ \frac{-28.2255}{-0.4336}=x \\ 65.09=x \end{gathered}[/tex]

This means that when a person works 65 hours approximately, he will have 10 hours of recreational activities every week.

4^2 * 4^3 simplified

Answers

SOLUTION

Given the question in the image, the following are the solution steps to answer the question.

STEP 1: Write the given expression

[tex]4^2\ast4^3[/tex]

STEP 2: Simplify the expression using the law of indices

[tex]\begin{gathered} \mathrm{Apply\:exponent\:rule}:\quad \:a^b\cdot \:a^c=a^{b+c} \\ 4^2\cdot \:4^3=4^{2+3} \\ =4^{\left\{2+3\right\}} \\ =4^5=1024 \end{gathered}[/tex]

Hence, the evaluation gives:

[tex]1024[/tex]

(08.01 MC)Find the height of a square pyramid that has a volume of 12 cubic feetand a base length of 3 feet. (1 point)

Answers

Recall that we can do the following picture

We want to find the height of this pyramid and are told the volume of the pyramid. Recall that the volume of a square pyramid of height h and base length b is given by the formula

[tex]V=\frac{1}{3}b^2\cdot h[/tex]

In our case, we have V=12, and b=3. So we have the following equation

[tex]12=\frac{1}{3}\cdot3^2\cdot h=3\cdot h[/tex]

So, we should find the value of h from this equation. To do, we simply divide both sides by 3, so we get

[tex]h=\frac{12}{3}=4[/tex]

so the height of the pyramid is 4 feet.

FEΗIdentify the similar triangles.ΔH FEΝΔΔΗFE Δ

Answers

According to the given figure, the common parts between triangles are angle G, side GH and angles H and E being equal to 90°.

So, the similar triangles are FHG and HEG because that's the position where the corresponding equivalent parts match.

Additionally, triangle HFE would be similar to triangles FGH and HGE.

RATIOS, PROPORTIONS, AND PERCENTSFinding the principal, rate, or time for a simple interest loan...Ann took out a loan for $17,000 and was charged simple interest at an annual rate of 6.8%.The total interest she paid on the loan was $867.How long was the loan for, in months?Do not round any intermediate computations. If necessary, refer to the list of financial formulas.monthsI need help with this mathProblem

Answers

The time formula for simple interest is:

[tex]t=\frac{I}{Ci}[/tex]

Where I is the interest, C is the capital and i is the rate

In this case, we have:

I= 867

i=6.8%

C=17000

Replace and solve:

[tex]t=\frac{867}{17000*0.068}[/tex][tex]t=0.75\text{ years}[/tex]

The time is 0.75 years because the rate is in years.

Convert years to months:

[tex]0.75years*\frac{12months}{1years}=9\text{ months}[/tex]

A map is created on a coordinate plane . Typ's house is located at (7,8) and the library is located at (7,-6) Each unit on the coordinate plane represents 1 block. How many blocks is it from Ty's house to the library? explain

Answers

We will have to calculate the distance between the two points ( that is between Ty's house to library

[tex]\text{distance betw}en\text{ two points = }\sqrt[]{(x_2-x_1)^2+(y_2-y_1)^2}[/tex][tex](x_1,y_1)=(7,8)and(x_2,y_2)=(7,-6)_{}[/tex][tex]\begin{gathered} d=\text{ }\sqrt[]{(7-7)^2+(-6-8)^2}\text{ =}\sqrt{\text{ }0^2+(-14)^2}\text{ =}\sqrt[]{14^2\text{ }} \\ d=\text{ 14} \end{gathered}[/tex]

There are 14 blocks between Ty's house to the library

I don't understand how to do either elimination or substituion.

Answers

We will solve by elimination as follows:

-3x - 8y = 20 [We multiply one of the equations by a number so we obtain an equal value in one of them]

8(-5x + y = 19)

-----------------------

-3x - 8y = 20

-40x + 8y = 152

------------------------- [We now add both expressions and solve for the resulting equation]

-43x = 172 => x = -4

Now that we know the value of one of the variables we replace this in one of the first equations:

=> -3(-4) - 8y = 20 => 12 -8y = 20=>-8y = 8 => y = -1

So, from this, we have that the solution for the system is (-4, -1)

Suppose that y varies directly as the square root of x, and that y = 25 when x = 289. What is y when x= 134? Round your answer to two decimal places if necessary.

Answers

Answer

When x = 134, y = 17.02

Explanation

We are told that y varies directly as the square root of x.

y ∝ √x

Introducing the constant of proportionality, k

y = k√x

We are then told that

when y = 25, x = 289, with this, we can solve for k

y = k√x

25 = k × √289

25 = k × 17

25 = 17k

17k = 25

Divide both sides by 17

(17k/17) = (25/17)

k = (25/17)

We are then to solve for y when x = 134

y = k√x

y = (25/17) × √134

y = (25/17) × 11.58

y = 17.02

Hope this Helps!!!

Michael and Karim are eating buffalo wings at a constant rate. Michael can eat 5.5 wings per minute. Karim's eating information is shown in the table below. Time (minutes) Wings eaten 1 6 2 12 18 3if they both ate 6 min how many wings would each person eat

Answers

a) Karim eats faster

b) Number of wings Micheal will eat = 33 wings

Number of wings Karim will eat = 36 wings

Explanation:

a) Michael eat 5.5 wings per minute

we need to find the constant rate Karim eats from the table

The constant rate = change in wings eaten/ change in time

The constant rate = (12 - 6)/(2-1) = (18-12)/(3-2)

= 6/1 = 6/1

The constant rate Karim eats = 6 wings per minute

Rate of Mcheal eating = 5.5

Rate of Karim eating = 6

Karim eats faster

Reason: Because Karim consumes more wings than Micheal when they are given same time, he will eat faster.

6 > 5.5

b) If they both ate 6 min:

Number of wings = rate × time

Number of wings Micheal will eat = 5.5 × 6 = 33 wings

Number of wings Karim will eat = 6 × 6 = 36 wings

If Karen has 6 cups of oatmeal and she divides it into 1/3 cup servings, how many servings of oatmeal will she have?

Answers

Problem

If Karen has 6 cups of oatmeal and she divides it into 3/4 cup servings, how many servings of oatmeal will she have? ​

Solution

For this case the operation that we need to do is:

[tex]\frac{6\text{cups}}{\frac{3}{4}\frac{\text{cups}}{\text{serving}}}=\frac{6\cdot4}{3}==\frac{24}{3}=8\text{servings}[/tex]

And for this case the final answer would be 8 servings

Sketch a line of best fit: The graph shows the depth y in centimeters of water filling a bathtub after x minutes. An equation for this line of best fit could be y = 2.4x-3.2. Use the sketch tool to sketch the line of best fit. A) interpolate: Use the given data to determine how much water is in the tub after 7 min. B) Extrapolate: Use the model (your equation) to predict the amount of water in the tub after 30 min. (Extrapolate means you are outside the known data.) I just want to make sure I created the line of best fit and that my answers to each question are correct.

Answers

The given equation of the line that best fits the data is:

[tex]y=\text{2}.4x-3.2[/tex]

In order to graph it we can solve the equation for different x-values, and then find the coordinates of the points to draw the line.

For x=2, the y-value is:

[tex]\begin{gathered} y=2.4\cdot2-3.2 \\ y=4.8-3.2 \\ y=1.6 \end{gathered}[/tex]

For x=7, the y-value is:

[tex]\begin{gathered} y=2.4\cdot7-3.2 \\ y=16.8-3.2 \\ y=13.6 \end{gathered}[/tex]

And for x=12, the y-value is:

[tex]\begin{gathered} y=2.4\cdot12-3.2 \\ y=28.8-3.2 \\ y=25.6 \end{gathered}[/tex]

Then, by placing these 3 points in the coordinate plane, we can draw the line, as follows:

The graph with the given points is:

b. Interpolate: the water is in the tube after 7 minutes 13.6 centimeters. We have already made the calculation in part a. When x=7, then y=13.6

c. Extrapolate: the amount of water after 30 minutes will be:

[tex]\begin{gathered} y=2.4\cdot30-3.2 \\ y=68.8 \end{gathered}[/tex]

The predicted amount of water after 30 minutes will be 68.8 centimeters.

List the sides of FGH in order from least to greatest if m

Answers

We have a triangle FGH

The three angles of the triangle FGH are given as

[tex]\begin{gathered} m\angle F=4x+7 \\ m\angle G=5x-31 \\ m\angle H=7x-52 \end{gathered}[/tex]

Recall that the sum of all three angles of a triangle must be equal to 180°

[tex]\begin{gathered} m\angle F+m\angle G+m\angle H=180\degree \\ 4x+7+5x-31+7x-52=180 \\ 16x-76=180 \\ 16x=180+76 \\ 16x=256 \\ x=\frac{256}{16} \\ x=16 \end{gathered}[/tex]

Now, we can calculate the exact measure of the angles

[tex]\begin{gathered} m\angle F=4x+7=4(16)+7=64+7=71\degree \\ m\angle G=5x-31=5(16)-31=80-31=49\degree \\ m\angle H=7x-52=7(16)-52=112-52=60\degree \end{gathered}[/tex]

Let us draw the triangle FGH

Recall that the side opposite the least angle is the least side and vice versa.

The means that the side opposite the angle G is the least side (FH)

Then the side opposite the angle H is the greater side (FG)

Finally, the side opposite the angle F is the greatest side (GH)

Therefore, the sides of the triangle FGH in order from least to greatest is

FH, FG, GH

A) What does the point (1,8) represent in the context of the situation? B) Is the amount of money proportional to the number of hours worked? C) Write an equation that represents this situation? D) What will be Amber’s Wages after 6 hours worked?

Answers

Answer:

A) Amber's wages for 1 hour is $8.

B) Yes

C) y = 8x

D)

Explanation:

A) Looking at the graph, we can deduce that the point (1, 8) shows how much Amber makes in one hour. So in 1 hour, Amber makes $8.

B)To determine whether the amount of money is proportional to the number of hours worked, we have to look at the graph and see if it starts from the origin (0, 0), if it does then we can conclude that they are proportional.

Since the graph starts from the origin (0, 0), then the amount of money is proportional to the number of hours worked.

C) The slope-intercept equation of a line is given as;

[tex]y=mx+b[/tex]

where m = slope of the line

b = y-intercept of the line

So let's go ahead and determine the slope of the line at points (1, 8) and (2, 16) using the below formula;

[tex]m=\frac{y_2-y_1_{}_{}_{}}{x_2-x_1_{}}=\frac{16-8}{2-1}=\frac{8}{1}=8[/tex]

Since the line starts from the origin, therefore the y-intercept, b, is zero.

Since m = 8 and b = 0, the equation can then be written as;

[tex]\begin{gathered} y=8x+0 \\ y=8x \end{gathered}[/tex]

D

PLS HELP FAST I WILL GIVE 25 POINTS simplify 10^6/10^-3. answers:A. 1/10^3. B. 1/10^18. C. 10^3. D. 10^9

Answers

D

Let's simplify that expression

1) Remember of the Exponents Rule, we have to subtract them

2) Note that for the exponents 6 -(-3) = 6+3 = 9 So it's D

The constant of variation for a function is 2. Which of the following graphs best represents this situation

Answers

The required graph shows the constant of variation for a function is 2 is A and B. Option A and B is correct.

Given that,
To determine the graphs which show the constant of variation for a function is 2.

What is proportionality?

proportionality is defined as between two or more sets of values, and how these values are related to each other in the sense are they directly proportional or inversely proportional to each other.

here,
in the graphs only graph, A and B show the given condition of the constant of variation for a function is 2. Because in both graphs shows that y = 2x  and 2y = x.

Thus, the required graph shows the constant of variation for a function is 2 is A and B. Option A and B is correct.

Learn more about proportionality here: https://brainly.com/question/22620356

#SPJ1



There are 14 girls and 12 boys in a class. What is the ratio of gris to students in simplest form

Answers

Number of girls = 14

Number of boys = 12

Number of students = 14 + 12 =26

Ratio of girls to students = 14/26 = 7 : 13

Is this correct? If not can you show me how to do it?

Answers

D. The rental cost in dollars, for each paddleboard.

Explanation:

You were in the right track with linking 40 to the paddleboards.

But remember that t represent the total cost and not the total number of paddleboards and kayak, and also since p represent the number of paddleboards (while k represent the number of kayak)

To find t, you need to sum the cost of all the kayaks and the sum of all the paddleboards.

=> t = 25k + 40p

with 25k = total cost of all the kayaks

and

with 40p = total cost of all the paddleboards => in others words the total number of paddleboards (p) * the cost of each paddleboards (40)

I need help with number 7 the first question on the top of the page please

Answers

SK= 13x-5

KY= 2x+9

SY=36-x

By looking at the line segment we can state:

SY = SK+KY

Replacing with the values, and solving for x:

36-x=13x-5+2x+9

Sum and subtract alike terms

36+5-9=13x+2x+x

32= 16x

Divide both sides by 16:

32/16=16x/16

2=x

Replace the value of x in each expression:

SK= 13x-5=13(2)-5=26-5=21

KY= 2x+9=2(2)+9=4+9=13

SY=36-x =36-(2)=34

So, the answers are:

x=2

SK=21

KY=13

SY=34

Susan earns 0.5% interest annually in her savings account. she can model her savings account balance after earning interest for a year as fx=x+0.005x or just fx=1.005x where x is the account balance

Answers

The balance of her account after one year, using simple interest, will be of

$30,150.

How to obtain the balance using simple interest?

The balance of an account after t years, using simple interest, that is, a single compounding per year, is given by the equation presented as follows:

A(t) = A(0)(1 + rt).

In which the parameters of the equation are explained as follows:

A(0) is the value of the initial deposit.r is the interest rate, as a decimal.

Considering that she has $30,000 in her account and the interest rate of 0.5%, the values of the parameters are given as follows:

A(0) = 30000, r = 0.005.

Hence the balance after one year will be of:

B(1) = 30000(1 + 0.005) = $30,150.

Missing Information

The problem asks for the balance after one year, if she started with $30,000 in her account.

More can be learned about simple interest at https://brainly.com/question/25793394

#SPJ1

If y=-4 when x = 10, find y when x = 2.

Answers

With the help of the cross-multiplication method, we know that the value y is -4/5 when x is 2.

What do we mean by the cross-multiplication method?

In mathematics, more specifically in elementary arithmetic and elementary algebra, one could cross-multiply an equation between two fractions or rational expressions to make the equation easier or to determine the value of a variable.

To cross-multiply two fractions, multiply the numerator of the first fraction by the denominator of the second, and the numerator of the second fraction by the denominator of the first.

So, the value of y when x = 2 is:

We know that when y = -4, then x = 10.

Now, calculate y when x = 2.

y/x = y/x

-4/10 = y/2

10y = -8

y = -8/10

y = -4/5

Therefore, with the help of the cross-multiplication method, we know that the value y is -4/5 when x is 2.

Know more about the cross-multiplication method here:

https://brainly.com/question/28839233

#SPJ1

simple interest interest: $50principal:$350rate: 6.5time:x

Answers

Given:

Interest (SI) = 50

Principal (P) = 350

rate (R) = 6.5. (Here, rate is 6.5 %)

To find time,

[tex]\begin{gathered} S\mathrm{}I\mathrm{}=P\times R\times T \\ 50=350\times\frac{6.5}{100}\times x \\ x=\frac{50}{22.75} \\ x=2.197 \\ x\approx2\text{ years ( approximated) } \end{gathered}[/tex]

Answer: x = 2 years.

3. Marisol made 12 cups of party mix. She gave 3 cups to her mother and 3 cups to her grandmother. How much party mix did Marisol have left for herself? 3 cups ( 6 7 cups 4 cups 6 cups

Answers

We will have the following:

[tex]12-2(3\frac{3}{4})=12-2(\frac{12}{4}+\frac{3}{4})[/tex][tex]=12-2(\frac{15}{4})=\frac{9}{2}[/tex][tex]=4\frac{1}{2}[/tex]

So, she will have 4 & 1/2 cups.

if your able to answer all of them i will be giving you 5 stars

Answers

The function given is:

[tex]f(x)=-16x^2+60x+16[/tex]PART A

The factorization steps are shown below:

[tex]\begin{gathered} f(x)=-16x^2+60x+16 \\ f(x)=4(-4x^2+15x+4) \\ f(x)=4(-4x^2+16x-x+4) \\ f(x)=4(-4x(x-4)-1(x-4)) \\ f(x)=4(-4x-1)(x-4) \end{gathered}[/tex]PART B

To find the x intercepts, we set f(x) equal to 0 and solve for x:

[tex]\begin{gathered} f(x)=4(-4x-1)(x-4) \\ f(x)=0 \\ 4(-4x-1)(x-4)=0 \\ -4x-1=0--------(1) \\ OR \\ x-4=0---------(2) \end{gathered}[/tex]

Solving (1), we have:

[tex]\begin{gathered} -4x-1=0 \\ 4x=-1 \\ x=-\frac{1}{4} \\ x=-0.25 \end{gathered}[/tex]

and, solving (2), we have:

[tex]\begin{gathered} x-4=0 \\ x=4 \end{gathered}[/tex]

The x-intercepts are

[tex]\begin{gathered} x=-0.25 \\ x=4 \end{gathered}[/tex]

PART C

The standard equation of a quadratic is

[tex]f(x)=ax^2+bx+c[/tex]

The parabola opens upward when a is positive and opens downward when a is negative

1. When parabola opens upward, the end behavior can be described as:

[tex]\begin{gathered} x\rightarrow\infty \\ y\rightarrow\infty \\ \text{and} \\ x\rightarrow-\infty \\ y\rightarrow\infty \end{gathered}[/tex]

2. When parabola opens downward, the end behavior can be described as:

[tex]\begin{gathered} x\rightarrow\infty \\ y\rightarrow-\infty \\ \text{and} \\ x\rightarrow-\infty \\ y\rightarrow-\infty \end{gathered}[/tex]

Our equation has an "a" value that is negative! So, the parabola opens downward and the end behvaior can be described as:

As x goes to infinity (gets infinitely large), y goes to negative infinity (gets infinitely small) and as x goes to negative infinity (gets infinitely small), y goes to negative infinity (get infinitely small).

PART D

In Part B, we found the x-intercepts. Those are the x-axis cutting points. We can draw those first.

Then,

Using the end behavior information that we found in Part C, we can draw the parabola. The rough sketch is shown:

The exact graph is shown below, for reference:

Question 8 of 10The table below shows the number of e-mails received each day by acompany employee for two separate weeks. If the data were represented witha comparative dot plot, which day would have more dots for week 2 than forweek 1?Week 1 Week 2Monday74.Tuesday83Wednesday52Thursday97Friday69

Answers

Solution

It's Friday

Because, the number of dots for week 2 is 9, while the number of dots for week 1 is 6.

Hence, the correct option is A.

1. Graph each of the following equations below using a tale of values or by another method. Fill in theInformation for each graph.X-intercept:a) y = x2 + 4x - 5y-intercept:хуVertex:Max/MinAxis of SymmetryDomain:Range:

Answers

The equation is

[tex]y=x^2+4x-5[/tex]

We can already find the vertex using the vertex formulas

[tex]\begin{gathered} x_V=-\frac{b}{2a}=\frac{-4}{2}=-2 \\ \\ \\ y_V=-\frac{\Delta}{4a}=-\frac{b^2-4ac}{4a}=-\frac{16+20}{4}=-\frac{36}{4}=-9 \end{gathered}[/tex]

Therefore the vertex is

[tex](x_V,y_V)=(-2,-9)[/tex]

Now we have the vertex we also have the axis of symmetry and the max/min of the function, in that case, it's a minimum because a > 0. Therefore

[tex]\begin{gathered} \text{ axis of symmetry = }x_V=-2 \\ \\ \min\lbrace y\rbrace=y_V=-9 \end{gathered}[/tex]

We can find the x-intercept easily

[tex]\begin{gathered} x=\frac{-b\pm\sqrt{b^2-4ac}}{2a} \\ \\ x=\frac{-4\pm\sqrt{4^2+4\cdot5}}{2} \\ \\ x=\frac{-4\pm\sqrt{16+20}}{2} \\ \\ x=\frac{-4\pm\sqrt{36}}{2} \\ \\ x=\frac{-4\pm6}{2} \\ \\ \end{gathered}[/tex]

Hence

[tex]\begin{gathered} x=\frac{-4\pm6}{2}=-2\pm3 \\ \\ x_1=-1 \\ x_2=-5 \end{gathered}[/tex]

The y-intercept is just the c value, then it's -5.

Now we can do the domain, there's no restriction for parabolas in the domain, then

[tex]\text{ domain = }\mathbb{R}[/tex]

And the range is

[tex]\text{ range = \lbrack}y_V,+\infty)=[-9,+\infty)[/tex]

Other Questions
Business is projected to be booming afterthe latest release of The Fast and theFurious 3.14159265359... Carver's AutoCustom must determine how many cansof paint and rims to stock at theirShanghai location.The Carver Family did choose WarehouseSpace A. The warehouse includes 8000sq. ft. of showroom and workshop space.One half of this warehouse space will beused to stock paint cans and rims. Thewarehouse has a height of 20 ft.Calculate the maximum numberof cylindrical paint cans thatCarver's Auto Custom can stock,if the paint comes in a 2-packhazmat box that measures 15 A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write the mRNA that would be transcribed from this DNA fragment.b) Circle the starter and the stopper in your mRNA sequence. Write the sequence of amino acids which would be encoded in translation. Use the mRNA codon table provided.c) Where in the cell do transcription and translation occur? Show your steps when solving the problem below. Container A has 800 mL of water and is leaking 6 mL per minute. Container B has 1,000 mL of water and is leaking minute. How many minutes will it take for the two containers to have the same amount of water? "For theWhich is a minor claim that should not be included ina summary? in the history of slavery in western civilization, the basic patterns of slavery were not racialized until? The table shows the highest maximum temperature for the month of October in Philadelphia Pennsylvania over the yearsPart A identify the independent and dependent quantity in their units of measure?Part B identify the equation of line of best fit using the data table.what is the slope and y-intercept of the line and what do they represent? How many times larger is 6 108 than 3 10-4? 7. Solve the following set of equations: 3x - 7y=-4 and 2x - 5y = -3a. (1, 2)b. (2, 1)c. (-2,-1)d. (1, 1)e. (-1,-1) You ordered from an online company. The original price of the item is $65. Theitem is on sale for 10%, and you have a coupon for an additional 15%. Applying onediscount at a time, what is the final price?$46.96$49.73$49.47$45.45 After the end of an advertising campaign, the daily sales of a product fell rapidly, with daily sales given by S=3800e0.05x dollars, where x is the number of days from the end of the campaign.a. What were daily sales when the campaign ended?b. How many days passed after the campaign ended before daily sales were below half of what they were at the end of the campaign? Joseline is trying out a new piece of photography equipment that she recently purchased that helps to steady a camera with one single leg instead of three. What type of equipment is Joseline trying out?A. multi-podB. tripodC. semi-podD. monopod DNA Extraction Lab. 1. Where did the DNA you are seeing come from? (Based on the method given below). Free Brainliest if right!Why is Mary Salter Ainsworth a central figure in psychology? Lila's retirement party will cost $8 if she invites 4 guests. If there are 9 guests, how much will Lila's retirement party cost? Solve using unit rates. Multiply binomial by polynomials In your own words, give a general description of the species, *wolf spiderIn your description make sure to include the scientific name and identification, its trophic level, its role in the food chain/web, and what biomes it may reside in. Please help 50 points!1.A cylindrical jar has a radius of 6 inches and a height of 10inches. The jar is filled with marbles that have a volume of 20 in3. Use 3.14 for pi. Show work. Complete sentences. What is the volume of the jar? do you know what complex numbers are? Can you divide two complex numbers? Give us an example here! the volume of a right cone is 27 units^3. if its height is 9 units find its circumference in terms of . 27y over 15y in lowest terms