A student cafeteria has 24 tables, tables X has 4 seats each, tables Y has 6 seats each, and tables Z has 10 seats each. The total seating capacity of the cafeteria is 148. For a student meeting, half of tables X, 1/4 of tables Y, and 1/3 of tables Z will be used, for a total of 9 tables. Determine X, Y, and Z. ( Answer the final answer in a full sentence. )

A Student Cafeteria Has 24 Tables, Tables X Has 4 Seats Each, Tables Y Has 6 Seats Each, And Tables Z

Answers

Answer 1

Answer: For a meeting, half of x, 1/4 of y, and 1/3 of z will be used for a total of 9 tables:

[tex]\begin{gathered} x+y+z=9 \\ \\ \\ \\ \frac{1}{2}x=\frac{4}{2}=2 \\ \\ \frac{1}{4}y=\frac{6}{4}=\frac{3}{2} \\ \\ \frac{1}{3}z=\frac{10}{3} \\ \\ \text{ Since we have a total of 9 tables therefore we have:} \\ \\ 3x+3y+3z\Rightarrow\text{ Total number of chairs.} \\ \\ 3(2)+3(\frac{3}{2})+3(\frac{10}{3})=6+\frac{9}{2}+10 \\ \\ \\ \text{Therefore:} \\ \\ ------------------------------- \\ \\ x=6 \\ \\ y=\frac{9}{2} \\ \\ z=10 \end{gathered}[/tex]

Therefore the x = 6 and y = 9/2 and z = 10 is the answer.


Related Questions

Question 5 of 10According to this diagram, what is cos 16°?

Answers

Explanation

We are given the following:

We are required to determine the value of cos 16° from the diagram given.

We know that according to the trigonometry ratio rules:

[tex]\cos\theta=\frac{adjacent}{hypotenuse}[/tex]

So, we have:

[tex]\cos16\degree=\frac{24}{25}[/tex]

Hence, the answer is:

[tex]\cos16\operatorname{\degree}=\frac{24}{25}[/tex]

i added the choices for the first box as well.

Answers

Looking at the triangles, we see that they have two congruent sides, and the angles between them are congruent too.

Then, the two triangles are related by side-angle-side (SAS), so the triangles are congruent (SAS theorem).

4. A farmhouse shelters no more than 12 animals. Some are goats and some are ducks.Altogether there are more than 34 legs. How many of each animal could there be?What are you being asked to find?What are you given?Define your variables.Create & solve a system.Explain your solution(s).

Answers

• What are you being asked to find? define your variables

We are being asked to find the number of goats and ducks that there might be in the farmhouse.

• What are you given?

,

From the information given by the question, we know that there are as many as 12 animals and that they have as many as 34 legs.

• Create & solve a system

from the given information we can write two expressions, one for the total number of animals, which equals 12, and another for the number of legs, let's call x to the number of goats and y to the number of ducks.

We know that there are a total of 12 animals, this is the number of goats plus the number of ducks, then we can write the expression:

goats + ducks = 12

x + y = 12

0.

And we know that there are 34 legs since a duck has 2 legs and a goat has 4, the number of legs of all the ducks would be the number of ducks times 2 and the number of legs of all the goats is 4 times the number of goats, then we can express the equation:

goat's legs + duck's legs = 34

4x + 2y = 34

Then, the system of equations that we have to solve is:

1. x + y = 12

2. 4x + 2y = 34

Now let's solve the system of equations, by following these steps:

Solve for y from the first equation:

x+y=12

x-x+y=12-x

y=12-x

Replace the expression y=12-x into the second equation and find the value of x.

4x + 2y = 34

4x+2(12-x)=34

4x+2*12-2x=34

4x+24-2x=34

2x+24=34

2x+24-24=34-24

2x=10

2x/2=10/2

x=5

Now that we know that x equals 5, let's replace it into the expression y=12-x, to find the value of y:

y=12-x

y=12-5=7

Then, x equals 5 and y equals 7

• Explain your solution

,

In the farmhouse could there be a total of 5 ducks and 7 goats

Simplify the Expression [tex]12g + 3 - g {}^{2} + 2[/tex] g=4

Answers

[tex]\begin{gathered} 12g+3-g^2\text{ + 2g = 4} \\ 12g+2g-g^2\text{ + 3 - 4 = 0} \\ 14g-g^2\text{ - 1 = 0} \end{gathered}[/tex]

done

What is the slope-intercept form of the line with the point (0, 3) and a slope = -2?O A. y = 2x + 3O C. y = -2x + 3D. y = -2x - 3B. y = 2x - 3

Answers

The form of the linear equation is

[tex]y=mx+b[/tex]

m is the slope

b is the y-intercept

The given equation is

[tex]y=-2x+3[/tex]

Compare it with the form above to find m and b

Since the coefficient of x is -2, then

m = -2

Since m is the slope of the line, then

The slope of the line is -2

The answer is B

Consider parallelogram QRST below.Use the information given in the figure to find m ZR, x, and m ZROS.R.4x1275040°7S

Answers

The opposite angles of a parallelogram are equal, therefore:

[tex]\begin{gathered} m\angle R=m\angle T \\ so\colon \\ m\angle R=75 \end{gathered}[/tex]

Opposite sides of a parallelogram are parallel and equal so:

[tex]\begin{gathered} QT=RS \\ 4x=12 \\ x=\frac{12}{4} \\ x=3 \end{gathered}[/tex]

∠TSQ and ∠RQS are alternate interior angles, therefore:

[tex]\begin{gathered} m\angle RQS=m\angle TSQ \\ so_{}\colon \\ m\angle RQS=40 \end{gathered}[/tex]

Given the right triangle find the value of sec(90 degree - theta) when a= 12, b= 5, c= 13

Answers

Use the next trigonometric identities:

[tex]\begin{gathered} \sec (90º-\theta)=\frac{1}{\cos (90º-\theta)} \\ \\ \cos (90º-\theta)=\sin \theta \end{gathered}[/tex]

Then, the sec(90º - θ) is:

[tex]\sec (90º-\theta)=\frac{1}{\sin \theta}[/tex]

The sin(θ) is:

[tex]\sin \theta=\frac{opposite}{hypotenuse}=\frac{5}{13}[/tex]

Then:

[tex]\sec (90º-\theta)=\frac{1}{\frac{5}{13}}=\frac{13}{5}[/tex]

Then, the sec(90º - θ) is 13/5

logitechExample 6:Triangle XYZ is graphed below. Draw and label Triangle X'Y'Z' after a dilation using a scale factor oftwo.I.113XWhat will be the coordinates of point Y" after a reflection of polygon X'Y'Z' over the x-axis?Answer

Answers

First answer:

Second Answer:

The coordinates of the Y'' after reflection of poligon X'Y'Z' over the x axis: (-2, -4)

The following scatter plot represents the relationship between a person's weight and the number of calories the person burns in one minute of jump roping. What type of relationship is shown?

Answers

The scatter plot shows a positive correlation because the points show a linear-trend describing that when x-values (weight) increases then y-values (calories) also increases.

Hence, the relationship is a Positive correlation.

Linus leaves his house and walks 7 blocks West to avoid Lucy. He then walks 3 blocks North to visit Charlie Brown. What is the shortest distance between the houses? Round to the nearest tenth.

Answers

First, draw a schematic representation of that situation:

The shortest distance between the starting point (Linus's house) and the endpoint (Charlie's house) is a straight line. Since a right triangle is formed with the sides of length 7 blocks and 3 blocks, we can use the Pyhtagorean Theorem to find the length of the hypotenuse:

[tex]\begin{gathered} ?=\sqrt[]{3^2+7^2} \\ =\sqrt[]{9+49} \\ =\sqrt[]{58} \\ \approx7.6 \end{gathered}[/tex]

Therefore, the shortest distance between those two points would be 7.6 blocks.

Item Price (dollars) $1,400 $2,400 $3,000 $4,400 Sales Tax (dollars) $112 $192 $240 $352 Based on the table, what is the rate of change? O The rate of change for the sales tax is $0.07 per dollar. O The rate of change for the sales tax is $0.08 per dollar. O The rate of change for the sales tax is $0.06 per dollar. The rate of change for the sales tax is $0.125 per dollar.

Answers

We know that the rate of change is a rate that describes how one quantity changes in relation to another quantity. If x is the independent variable and y is the dependent variable, then

[tex]r\text{ = }\frac{Change\text{ in y}}{\text{Change in x}}\text{ = }\frac{Y2-Y1}{X2-X1}[/tex]

where (X1,Y1) and (X2,Y2) are points of our model.

So, in this case we have that:

[tex]r\text{ = }\frac{Y2-Y1}{X2-X1_{}}\text{ = }\frac{112-352}{1400-4400}\text{ = }\frac{240}{3000}\text{ = 0.08}[/tex]

So, the correct answer is: the rate of change for the sales tax is $0.08 per dollar.

The function h is defined by h (x)=3x² - 4.Find h (3x).

Answers

When we have a function f(x) we can evaluate it for different arguments (the value of x) by replacing the argument in the definition of the function.

In this case, we know h(x) and we have to express h(3x). To do this, we replace x in the original function with 3x:

[tex]\begin{gathered} h(x)=3x^2-4 \\ h(3x)=3(3x)^2-4=3\cdot(3^2x^2)-4=3\cdot9x^2-4=27x^2-4 \end{gathered}[/tex]

Answer: h(3x) = 27x²-4

Find the circumference of a circle with a Diameter = 12 m. Use 3.14 for π and round to 2 decimal places. ANS. C= B_____________. m

Answers

The circumference of a circle is given by the formula

[tex]s=2\cdot\pi\cdot r[/tex]

however we also knos that the diameter can be written as

[tex]D=2\cdot r[/tex]

meaning that the formula for the circumference can also be written as

[tex]s=D\cdot\pi[/tex]

then the circumference for the given information is:

[tex]\begin{gathered} s=12\cdot3.14 \\ s=37.68 \end{gathered}[/tex]

Part 1: Person A has a car with the average fuel consumption of 20 miles per gallon. Person B has an average fuel consumption of 30 miles per gallon. Person C has an average fuel consumption of 40 miles per gallon. they are trying to work out how much fuel they will each save if they change cars. Person A, " I am going to buy Person B's car." Person B says, " I am going to buy Person C's car." Person C says that each week they will both save the same amount of fuel.Is person C correct? Part 2: Person C wants to buy a new car. Each week, he wants to save the same amount of fuel as person A saved. What average fuel consumption should person C look for in a new car?

Answers

Let's assum that each person drives 120 miles per week.

Then for person A we have:

[tex]\begin{gathered} 20mi\rightarrow1\text{gal} \\ 120mi\rightarrow xgal \\ \Rightarrow x=\frac{120}{20}=6gal \\ x=6\text{gal} \end{gathered}[/tex]

for person B we have:

[tex]\begin{gathered} 30mi\rightarrow1gal \\ 120mi\rightarrow xgal \\ \Rightarrow x=\frac{120}{30}=4gal \\ x=4\text{gal} \end{gathered}[/tex]

finally, for person C:

[tex]\begin{gathered} 40mi\rightarrow1gal \\ 120mi\rightarrow xgal \\ \Rightarrow x=\frac{120}{40}=3gal \\ x=3\text{gal} \end{gathered}[/tex]

Then, if person A changes to person B's car, we have that the save is:

[tex]6-4=2[/tex]

if person B buys person C's car, then the save is:

[tex]4-3=1[/tex]

therefore, the savings on gas will be different for both of them and person C is incorrect.

2)Since person A saved 2 gallons, then the new car for Person C must save 2 gallons for each mile traveled.

Then we have the following equation:

[tex]3-x=2[/tex]

where 'x' represents the number of gallons consumed in 120 miles. then, solving for x we have:

[tex]\begin{gathered} 3-x=2 \\ \Rightarrow-x=2-3=-1 \\ \Rightarrow-x=-1 \\ x=1 \end{gathered}[/tex]

therefore, person C will need to buy a car that uses 1 gallon for eah 120 miles traveled

Line Segment WV has an endpoint at (5, -7) and the midpoint is at (-3, 2). What are the coordinates of the other endpoint? Write your answer as an ordered pair: (x, y)

Answers

Answer:

Step-by-step explanation: it is that

Totsakan enlarged the size of a photo to aheight of 18 in. What is the new width if itwas originally 2 in tall and 1 in wide?

Answers

Let's begin by identifying key information given to us:

New size: Height = 18 in, Width = ?

Old size: Height = 2 in, Width = 1 in

We will get the width of the new photo by following the explanation below:

[tex]\begin{gathered} 18\colon2=x\colon1 \\ \Rightarrow\frac{18}{2}=\frac{x}{1} \\ \text{Cross multiply, we have:} \\ 2\cdot x=18\cdot1\Rightarrow2x=18 \\ 2x=18 \\ \text{Divide both sides by ''2'', we have:} \\ x=\frac{18}{2}=9 \\ \therefore x=9in \end{gathered}[/tex]

Therefore, the width of the enlarged photo is 9 inches

Does the equation x = 1 represent a function?How do I know if it represents a function if it doesn't have y axis to show if it is.

Answers

A function is a relation between variables y and x,

where theres only a y value for every x value

In this case x=1 . For every value of x = 1 ,there are infinite values for y , it can take any value , negative or positive.

So this is NOT a function

which functions are correctly graphed?

Answers

Solution

final answer is.

Choice A, C ,D

Is my answer correct? 3/4 + 9/16 = 3/16

Answers

Answer:

is not correct because the lcm will be 16 and u will get 21/16

A car travels 120 miles on 10 gallons of gas. At this rate, how many gallons will it need to travel 312 miles?

Answers

26 gallons

1) We can write this information setting up a proportion

miles gallons

120 10

312 x

2) Assuming the pace hasn't changed, then we can consider that as proportional:

120x = 312 * 10

120x= 3120

x = 3120/120

x =26

3) So 26 gallons are going to be needed for those 312 miles.

3. The height of a projectile object fired into the air can be modeled by h(t) = -16t² + 48t + 3, where his
height, in feet, and t is time, in seconds. What is the maximum height the projectile will reach?
A. 3 feet
B. 35 feet
C. 39 feet
D. 105 feet

Answers

Answer:

C. 39 feet

Step-by-step explanation:

[tex]{ \tt{h(t) = - 16 {t}^{2} + 48t + 3 }}[/tex]

- Let us find the limits of the function

[tex] { \tt{ \frac{d \{h(t) \}}{dt} = - 32t + 48 }} \\ [/tex]

- So, let us differentiate for the second time;

[tex]{ \tt{ \frac{d {}^{2} \{h(t) \} }{dt {}^{2} } = - 32}} \\ [/tex]

- So, at maximum height; d{h(t)}/dt is 0;

[tex]{ \tt{ - 32t + 48 = 0}} \\ { \tt{ - 32t = - 48}} \\ { \tt{t = 1.5 \: seconds}}[/tex]

- Therefore; maximum height is;

[tex]{ \tt{h(t) = - {16t}^{2} + 48t + 3}} \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \\ { \tt{h(1.5) = - 16(1.5) {}^{2} + 48(1.5) + 3}} \\ { \tt{h(1.5) = - 36 + 72 + 3}} \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \\ { \tt{h(1.5) = 39 \: feet}} \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: [/tex]

3. Find the median, range, and interquartile range for this data set. 21, 31, 26, 24, 28. 26 Median: Range: IQR:

Answers

The given data set is 21,31,26,24,28,26.

Arranging the data set in the ascending order,

21,24,26,26,28,31.

The data set contains 6 numbers,

The median can be determined by taking the average of 3rd and 4th term of the data set,

[tex]\begin{gathered} \text{Median}=\frac{26+26}{2} \\ =26 \end{gathered}[/tex]

Thus, the required median is 26.

The range can be determined by taking the difference between the highest and the lowest value of the data set,

[tex]\begin{gathered} \text{Range}=31-21 \\ =10 \end{gathered}[/tex]

Thus, the range of the data set is 10.

The interquartile range of the data set can be determined by taking the difference of quartile 1 and quartile 3.

[tex]\begin{gathered} \text{IQR}=Q_3-Q_1 \\ =28-24 \\ =4 \end{gathered}[/tex]

Thus, the required interquartile range is 4.

133/ 12 i need the answer

Answers

We will have:

[tex]\frac{133}{12}=11.08333\ldots\approx11[/tex]

The fraction is approximately 11.

John has 44 quarters.Jan has 100 dimes. Whohas more money?

Answers

Note that 10 dimes = $1

Also 4 quarters = $1

That means, 100 dimes equals $10

Also, 44 quarters =

write in algebraic expression1) quotient of a number b and 36 2) 45 divided into a number r3) sum of 21 and a number x4) a number z less 19 5) a number f divided by 6

Answers

Solution

For this case we can do the following:

1)

[tex]\frac{b}{36}[/tex]

2)

[tex]\frac{45}{r}[/tex]

3)

[tex]21+x[/tex]

4)

[tex]z-19[/tex]

5)

[tex]\frac{f}{6}[/tex]

i need help with math

Answers

Answer:

x = 33

Step-by-step explanation:

Creating an equation

The angles shown are corresponding angles

Corresponding angles are angles that occupy the same position and are on the same side of the transversal. For a better sense of this, kindly review the attached image.

Corresponding angles are congruent ( equal to each other )

This means that 124 = 4x - 8

Solving for x

124 = 4x - 8

==> add 8 to both sides

132 = 4x

==> divide both sides by 4

33 = x

Ignore the 58.I just need to find the m

Answers

The angles in the question are vertically opposite angles and Vertically opposite angles are equal.

Therefore,

[tex]\begin{gathered} (12x-37)^0=(9x+5)^0 \\ by\text{ collecting like terms we will have} \\ 12x^0-9x^0=5^0+37^0 \\ 3x^0=42^0 \\ \text{divide both sides by 3} \\ \frac{3x}{3}=\frac{42}{3} \\ x=14^0 \end{gathered}[/tex][tex]\begin{gathered} to\text{ measure }\angle y \\ 12x-37+y=180^0 \\ \text{substitute x=}14^0\text{ in the above equation to get y} \\ 12(14)-37^0+y^0=180^0 \\ 168^0-37^0+y=180^0 \\ 131^0+y=180^0 \\ y=180^0-131^0 \\ y=49^0 \end{gathered}[/tex]

Therefore,

[tex]\angle y=49^0[/tex]

Completing a race) Ned spent 63 minutes walking 11 while If the ratio of time walking to jogging was 9:1, race? 2 minutes did he spend completing the

Answers

While completing the race, Ned spent 63 min walking if the ratio of time walking to jogging was 9:1, how many minutes did he spend completing the race?

Let

x-----> time spent walking

y -----> tiime spent jogging

we have

x/y=9/1

x=9y -----> equation A

we have

x=63 min

substitute in the equation A

63=9y

solve for y

y=7 minutes

therefore

teh answer is

7 minutes

.a. Triangle ABC with coordinates A (3, 4), B (7,7), and C (8, 1) is translated 6 units left and 7 units down.

Answers

Triangle ABC with coordinates A (3, 4), B (7,7), and C (8, 1) is translated 6 units left and 7 units down.

we have that

the rule of the translation is

(x,y) -------> (x-6, y-7)

Applying the rule to the coordinates of triangle ABC

A(3,4) ------> A'(3-6,4-7)

A'(-3,-3)

B(7,7) ------> B'(7-6, 7-7)

B'(1,0)

C(8,1) --------> C'(8-6,1-7)

C'(2,-6)

I just need to know the answer to question 11

Answers

Answer:

A number line a closed circle on 8, shading to the left, and a closed circle on 11, shading to the right.

Explanation:

Given the compound inequalities:

[tex]x-1\le7\text{ or }2x\ge22[/tex]

First, solve both inequalities:

[tex]\begin{gathered} x-1\le7\implies x\le7+1\implies x\le8 \\ 2x\ge22\implies x\ge\frac{22}{2}\implies x\ge11 \end{gathered}[/tex]

Thus, the number line should be the one that represents the solution:

[tex]x\le8\text{ or }x\ge11[/tex]

• For x≤8, there is a ,closed circle on 8, and ,shading to the left.

,

• For x≥11, there is a ,closed circle on 11, and ,shading to the right.

Therefore, the correct description will be:

A number line a closed circle on 8, shading to the left, and a closed circle on 11, shading to the right.

The last option is correct.

Other Questions
Evaluate the determinant.7 3 28 2 76 8 5A) 212B) -464 -212D860 How did the French respond when the United States refused to pay debts owed to France. Question 4Below is the CODING STRAND of a small gene that codes for a peptide. Assume the gene has atraditional start codon.How many amino acids long is the peptide if we assume traditional start and traditional stopcodon?5' AATCCGTATCTATGACCGTTTGGAAACACTAAGCGGTACTC 3'3569 Which equations represent a linear function? Select two. a. y = x-1 b. y = 4.5 C. 3x 4y = 2 d. 5x2 = 10y e. y = 1/2x2 +6 suppose s and t are mutually exclusive events. find p (s or t) if p(s)=29% and p(t)=49% There are a total of 50 questions worth 130 points on Chenille's history exam. Someof the questions are worth five points each, and the other questions are worth twopoints each. Which of the following systems of equations could be used todetermine F, the correct number of five point questions, and t, the correct numberof two point questions answered correctly? 4. __H2SO4 + __Cr(OH)3 --> __Cr2(SO4)3 + __H2OYou have 4 moles of H2SO4. How many moles of H2O are produced? Which of the following is equal to ? 1/5^-2 ) What is the most notable difference between particles in the solid phase and the liquid phase? Express the following as an algebraic function of x.sin(sin-'(x) cos-'(x)) Convert 15 gal to quarts List the structure and functions of the main organs of the United Nations Question 4 please . Using a graphing utility (geogebra) to graph the function Identify the units you would expect for the given quantity.The price of a bottle of French perfume, found by multiplyingthe unit price of the perfume in euros per milliliter by thevolume of the bottle in milliliters. I have that sweatshirt for 10 years Locate the incorrect words in the following paragraph and add them to the columns with correct words. ( Passage Incorrect Correct Ones there was a King who _______ ________ thought only to himself. ________ ________ He only talked about her own charms _______ ________ and conquests in a court all day. _______ ________ He wants people to believe his tales _______ ________ and talk about his greatness to everyone. What are the coordinates of point w? 5 Z 3 2 Y 3 0 2 2. 4 -1 -2 W -3 -5 People's behavior can be determined by their subjective construction of reality rather than by objective reality. Fexample, a teenager who is repeatedly given a label-overachiever, player, bum-might live up to the term everthough it initially wasn't a part of his character - have you been ever given a lable or have you ever labled yourseexplain why or why not. You bought a magazine for $7 and some notepads for $5 each. You spend a total of $27 how many notepads did you buy. In AFGHFH.GF +40, HF 3x - 20, and GH find the value of 21 20