What must be the genotype of a couple that has a 100% chance of producing offspring that areheterozygous for the PTC taster gene?

In the experiment described in the tutorial, the investigators add a mutagen to the culture medium to increase the rate of evolutionary change in the viruses.

Any factor that results in a mutation (a change in the DNA of a cell). Mutagens can injure cells and cause some diseases, like cancer, by altering DNA. Radioactive elements, x-rays, ultraviolet rays, and certain compounds are examples of mutagens.

A virus is an infectious microorganism made up of a protein-coated segment of nucleic acid (either DNA or RNA). A virus can't multiply by itself; it has to infect cells in order to utilize the host cell's components to make copies of itself. Viruses are composed of bundles of DNA or RNA that are encased in a protein capsule called a capsid. Infectious agents that are acellular and must exist in the presence of a host cell in order to grow, viruses are frequently referred to as obligatory intracellular parasites. All cell types, including those in people, animals, plants, bacteria, yeast, archaea, and protozoa, have been proven to be susceptible to certain viruses.

Thus from above conclusion we can say that in the experiment described in the tutorial, the investigators add a mutagen to the culture medium to increase the rate of evolutionary change in the viruses.

Learn more about the virus here:

https://brainly.com/question/25236237

#SPJ1

Tentacles of an octopus as well limbs of a lizard are analogous structures.

Analogous structures or organs perform the same function in different organisms that bear no resemblance to each other anatomically. Analogous structures are formed as a result of convergent evolution, i.e. different structures evolving for the similar function and thus having similarity. Tentacles of an octopus as well as limbs of a lizard are used for the similar function, i.e. locomotion in this case.

On the other hand, homologous structures result from divergent evolution. Homologous organs contain a similar basic structure but perform distinct functions in different organisms.

To learn more about Homologous organs here

https://brainly.com/question/14963404

#SPJ1

Answer:

c) H₂0

Explanation:

H₂0 molecule (water) is the most common molecule in the human body. Hence, option (c) is the correct answer.

The TCA cycle typically generates 2 molecules of ATP (or GTP) from each molecule of glucose that is totally oxidized to 6 co2 molecules.

Its original definition, "the smallest unit of a substance that yet preserves the qualities of that substance," was intended to be encompassed by this designation. An atom is a body that cannot be divided into two, and a molecule is the tiniest unit of a certain material, according to James Maxwell's definition from 1873.

A molecule is a cluster of two or more atoms that can be divided into smaller recognizable units while still retaining the chemical make-up and physical characteristics of a pure material.

To know more about molecule visit :

https://brainly.com/question/14362857

#SPJ4

Answer:

The two types of cells are prokaryotic and eukaryotic.

Answer:

Prokaryote and Eukaryote Cells

Explanation:

A prokaryote cell is a cell which has no nucleus or membrane-bound organelles.

A Eukaryote cell is a cell which has a nucleus and membrane-bound nucleus.

Scientist use a dichotomous key to determine scientific names of things and it helps determine which cell is which.

https://brainly.com/question/6871687

https://brainly.com/question/16333970?referrer=searchResults

a) In order to transcribe the segment of DNA, it is important to note that this process is important for gene expression as a protein. An enzyme called RNA polymerase moves along the DNA until the end of the gene, releasing the mRNA. The DNA has two strands: one that goes from 5' to 3' direction, and another one that goes from 3' to 5' direction. The one that's used for transcription will always be the 3' to 5' one, so we already have the correct strand to work with, as it is a 3' to 5' strand.

However, the mRNA will be assembled in the 5' to 3' direction. Using the same complementary base-pairing rules as in DNA, we will pair Cytosine (C) with Guanine (G), but as there is no Thymine (T) in RNA, we will pair Adenine (A) with Uracil (U).

Therefore, the sequence o mRNA read in the 5' to 3' direction is:

5' CUAUGGAAACACAUCAGUAGAA 3'

b) The starter codon is the AUG codon of a messenger RNA (mRNA). Therefore, the sequence of amino acids will start to be decoded there.

The stopper codon can be one of the three following options: UAA, UAG or UGA. In this case, we can only find the UAG codon.

The codons, then will be:

AUG GAA ACA CAU CAG UAG

Then, we can say that the amino acids translated will be:

Met Glu Thr His Gln

(Methionine - Glutamine - Threonine - Histidine - Glutamine

c) In eukaryotes, transcription occurs inside the nucleus of the cell and translation occurs in the cytoplasm.

A lion, a crocodile, and a wild dog.

Answer:

The answer is A, stimulus

The volcanic eruptions has the release of volcanic gas and it provoke climate changes that has a negative effect on the environment.

Answer: Find your 5

Explanation:

Mesophytes generally require a more or less continuous water supply. They usually have larger, thinner leaves compared to xerophytes, sometimes with a greater number of stomata on the undersides of leaves. Because of their lack of particular xeromorphic adaptations, when they are exposed to extreme conditions they lose water rapidly, and are not tolerant of drought. Mesophytes are intermediate in water use and needs. These plants are found in average conditions of temperature and moisture and grow in soil that has no water logging. The roots of mesophytes are well developed, branched and provided with a root cap. The shoot system is well organised. The stem is generally aerial, branched, straight, thick and hard. Leaves are thin, broad in middle, dark green and of variable shape and measurement.[citation needed]For example, in hot weather they may overheat and suffer from temperature stress. They have no specific adaptations to overcome this, but, if there is enough water in the soil to allow this, they can increase their rate of transpiration by opening their stomata, thus meaning some heat is removed by the evaporating water. However these plants can only tolerate saturated soil for a certain amount of time without a warm temperature. In dry weather they may suffer from water stress (losing more water via transpiration than can be gained from the soil). Again they have no specific adaptations to overcome this, and can only respond by closing their stomata to prevent further transpiration. This does actually have some benefits as it reduces the surface area of the leaves exposed to the atmosphere, which reduces transpiration. Prolonged periods of dehydration, however, can lead to permanent wilting, cell plasmolysis, and subsequent death. Since mesophytes prefer moist, well drained soils, most crops are mesophytes. Some examples are corn (maize), cucurbits, privet, lilac, goldenrod, clover, and oxeye daisy

• Axial Skeleton,: A division of the skeleton consisting of the skull, thoraz and vertebral column

• Appendicular Skeleton,: A division of the skeleton composed of the girdle and limb bones

• Oviparous,: These organisms lay eggs that develop and hatch outside the mother.

• Viviporous,: These organisms nourish their offspring inside the mother during development and give birth to live young.

• Ovoviviparous,: These organisms carry their young in eggs inside the mother, when the eggs hatch, the mother gives birth to live young.

Answer:

The cell membrane, also called the plasma membrane, is found in all cells and separates the interior of the cell from the outside environment. The cell membrane consists of a lipid bilayer that is semipermeable. The cell membrane regulates the transport of materials entering and exiting the cell.

Explanation:

Answer: It converts corbon to dox

Explanation:

Answer:

they are usually considered to be a primary energy source.

Explanation:

The introduction of nutria affects a pond ecosystem food web because the saltwater marshes are destroyed by Nutria's ravenous eating habits.

Nutria's ravenous appetite for food causes the destruction of saltwater marshes, which reduces the amount of food and shelter available to other species and promotes severe erosion.

By devouring the wetland grasses, Nutria devastates the area's food chain and environment. A few invasive species seriously hurt the economy. The amount of above- and below-ground plant matter that nutria consume daily can reach up to 25% of their body weight.

Nutria obliterates the banks of ditches, lakes, and other bodies of water in addition to harming vegetation and agriculture. What's most important, though, is the long-term harm that nutria may do to wetlands like marshes.

To learn more about Nutria visit: https://brainly.com/question/17690670

#SPJ9

Crop monitoring makes use of space-based data to keep tabs on crop development and forecast crop yields for certain fields that have been planted.

A system for monitoring agriculture consists of a network with wireless sensors. These sensors gather information from several nodes positioned on the playing surface. Then, specialists or nearby farmers analyze this data. The data can be used to make a number of inferences about weather patterns, soil fertility, crop quality, etc. A system is developed for agricultural field monitoring in IoT-based modern agriculture with the aid of sensor like light, humid, temperatures, soil moisture, etc. Farmers may monitor the condition of thier fields from any location. IoT-based smart farming is considerably more efficient than conventional farming.

Nowadays, satellite techniques are widely employed in agriculture, and many farmers use them frequently to observe their fields and assess the condition of their crops. Crop monitoring is crucial for managing various pests, weeds, and diseases that affect crops. This gives information about the crop's current situation, and you can then look ahead in time to forecast what will probably be the crop's next problem.

To know more about Monitoring Systems visit:

https://brainly.com/question/28776835

#SPJ1

No. Water cannot be the only product of the combustion of propane because carbon dioxide is also formed simultaneously.

Generally, hydrocarbons undergo combustion reactions with oxygen. When this happens, complete combustion leads to the production of carbon dioxide and water. The general equation for the combustion of hydrocarbons is written as: [tex]C_nH_{2n+2} + (3n+1)/2 O_2 = n CO_2 + (n+1) H_2O[/tex]

Propane is a hydrocarbon with the chemical formula, [tex]C_3H_8[/tex]. Thus, when it burns in oxygen, the equation of the reaction becomes:[tex]C_3H_8 + 5O_2 -- > 3CO_2 + 4H_2O[/tex]

From this equation, we can see that not only water is produced when propane burns in oxygen, but carbon dioxide molecules as well. Thus, water cannot be the only product of propane combustion because another product, carbon dioxide, is also formed.

More on propane combustion can be found here:

https://brainly.com/question/3014094

#SPJ1

As DNA is being translated into RNA during gene expression, the non-coding regions are cut out by a procedure known as RNA splicing.

In the nucleus, transcription occurs. It constructs an RNA molecule from a template made of DNA. Translation takes place when RNA travels from the nucleus to a ribosome in the cytoplasm. A protein is created during translation by reading the genetic code in mRNA.

The information contained in a gene's DNA is transferred to RNA (ribonucleic acid), a molecule comparable to DNA, in the cell nucleus during transcription. Both RNA and DNA are composed of a series of units known as nucleotides.

To know more about rna visit:-

https://brainly.com/question/20914096

#SPJ4

Some ways in which octopuses have shown their intelligence in labs has been by completing various maze and opening tricky traps to acquire food rewards.

Octopuses are deep sea creatures who are well known for their 8 suction cups lined limbs along with their bulbous head and ink-secreting mechanism.

Of all the invertebrates octopuses are considered to be the most intelligent creatures.

They have a complex system of neurons that together act as a brain. This allows the octopus to perform various tasks such as touching animals and manipulating its surroundings or smell.

Apart from this all of the octopus's 8 arms can be moved independently from each other.

Some ways in which octopuses have shown their intelligence in labs has been by completing various maze and opening tricky traps to acquire food rewards.

Learn more about octopuses at:

brainly.com/question/26814725

The phytoplankton levels dropped enormously during the El Nino events.

Phytoplankton are the autotrophic organisms of the aquatic habitat. They are the beginners of the aquatic food chains. Phytoplankton belong to the category of algae. The species have the capability of buoyancy and float in the upper regions of the sea where sunlight can reach to them.

El Nino was the phenomenon where the temperature of the sea surface went unusually high. This lead to the occurrence of droughts, floods, and several other calamities. Since the temperature of the sea increased, the conditions turned unfavorable for the blooming of phytoplankton and that is why their population reduced.

To know more about El Nino, here

brainly.com/question/18307318

#SPJ1

The experimental result that displayed the central pattern generators' involvement in muscle contractions is that 'an insect in which the sensory afferents from the wings have been cut can fly', which suggests that option C is the right answer.

Central pattern generators are neuronal circuits which when activated produce rhythmic motor patterns such as walking, breathing or flying etc. in the absence of sensory signals. Muscle contraction refers to the activities such as tightening, shortening, or lengthening of muscles when some activity is performed by the body. It is caused due to the information signal received by the brain and then returned back to site of stimuli. The experiments conducted displayed that a deafferented locust could generate rhythmic flight motor patterns in response to non-rhythmic stimulation of the nerve cord.  

Learn more about Central pattern generators at:

brainly.com/question/15565886

#SPJ4

To refer to complete question, see below:

Which experimental results would demonstrate that central pattern generators are involved in producing the muscle contractions involved in rhythmic movement?

a. A cat whose cerebral cortex has been removed can walk and run on a treadmill.

b. A cat whose cerebral cortex has been removed has impaired balance on a treadmill.

c. An insect in which the sensory afferents from the wings have been cut can fly.

d. An insect in which the sensory afferents from the wings have been cut has an unusually slow wingbeat frequency.

Polarity is caused by electronegativity. Electronegativity is the ability of an atom to attract electrons and when in a molecule there is a region of low electronegativity and a region of high electronegativity we say that the molecule is polar.

Typically, the receptor kinase protein has a transmembrane domain. The non-receptor tyrosine kinase, though, lacks a transmembrane domain.

The main distinction between receptor tyrosine kinases and G protein coupled receptors is that the former can only cause one cell response from a single ligand binding, whereas the latter can cause multiple cell responses from a single ligand binding.

As a transmembrane RTK, HER2 is activated upon dimerization with another receptor from the epidermal growth factor family, such as EGFR (ERBB1), ERBB3 (HER3), and ERBB4 (HER4).

To know more about receptor visit:-https://brainly.com/question/29343237

#SPJ4

Answer:

Yes, Prokaryotic cells are much smaller than Eukaryotic Cells

Explanation:

Generally, Prokaryotic Cells are smaller as they contain less genetic material and other mechanisms to maintain that material.

No. Carbon dioxide cannot be the only product of the burning of propane. Water is also produced.

Generally, hydrocarbons undergo combustion reactions with oxygen. When this happens, complete combustion leads to the production of carbon dioxide and water.

The general equation for the combustion of hydrocarbons is written as: [tex]C_nH_{2n+2} + (3n+1)/2 O_2 = n CO_2 + (n+1) H_2O[/tex]

Propane is a hydrocarbon with the chemical formula, [tex]C_3H_8[/tex]. Thus, when it burns in oxygen, the equation of the reaction becomes:

[tex]C_3H_8 + 5O_2 -- > 3CO_2 + 4H_2O[/tex]

From this equation, we can see that not only carbon dioxide is produced when propane burns in oxygen, but water molecules as well.

Thus, carbon dioxide cannot be the only product of propane combustion because another product, water, is also formed.

More on propane combustion can be found here: https://brainly.com/question/3014094

#SPJ1

The comparison of the wave shape of an alligator’s low-frequency mating call with the wave shape of a frog’s high-frequency chorus in the way that their shapes are different is that The high-frequency shapes are relatively close together whereas the low-frequency waves are spaced out.

American alligators aren't afraid to make their presence known when they're looking for a mate, and the outcome might sound like a cross between a motorcycle and the loudest snorer ever. An image of a huge male making one of its loud grunting mating sounds is captured on camera.

So, Odorrana tormota and Huia cavitympanum are two species of frogs that are currently recognized for their ability to vocalize at high frequencies, or even partially ultrasonically. Both individuals' hearing systems have been specially modified so they can hear in the high-frequency band.

Therefore, While the high-frequency patterns are closely spaced apart, the low-frequency waves are elongated in both animals.

Learn more about low-frequency from

https://brainly.com/question/21890312

#SPJ1

Nondisjunction during meiosis 2 could produce a sperm with two x chromosomes.

Nondisjunction can occur during meiosis I and meiosis II, resulting in an abnormal gamete chromosome number. The main difference between meiosis 1 and meiosis 2 nondisjunction is that meiosis 1 does not separate homologous chromosomes, whereas meiosis II does not separate sister chromatids.

Nondisjunction means that the pair of homologous chromosomes did not separate or did not separate at anaphase so that both chromosomes of the pair end up in the same daughter cell. This probably occurs most frequently in meiosis, but can occur in mitosis to create mosaic individuals.

Meiotic nondisjunction can result in pregnancy loss or the birth of children with extra chromosomes in every cell, whereas mitotic nondisjunction results in mosaicism of two or more cell lineages. Aneuploidy can also result from late delay.

Learn more about meiosis from:

https://brainly.com/question/29383386

#SPJ4

Answer:

The correct answer option is True.

Explanation:

Volume can be measured in liters or cubic meters - it is true.

The measure of the amount of space which an object or a substance can occupy is said to be its volume.

The basic unit of volume in the metric system is a liter while the SI unit of the volume is the cubic meter.

Therefore, the given statement is true.

Answer:

Nautiluses made this development through years of evolution. They developed jet propulsion to help them to better outswim predators.

Explanation:

This is my answer, not a sample answer. Hopefully, it helps! :)