What are 3 processes that plants and/or animals undergo that lead to energy released as heat?

Answers

Answer 1

Answer:

Cell repair, photosynthesis and chemical reactions

Explanation:


Related Questions

Which example best describes a computer model that could be used to better
understand the function of the brain?
A. A simulation predicting the paths of electrical impulses through
the brain
B. A detailed re-creation of the brain in modeling clay that shows the
positions of its structures
C. A description of the brain as a computer processor that interprets
encoded information
D. A formula for calculating the time it takes a message from the
brain to reach a different part of the body

Answers

Answer: Which example best describes a computer model that could be used to better understand the function of the brain?

A. A simulation predicting the paths of electrical impulses through the brain is the best example of a computer model that could be used to better understand the function of the brain.

Explanation:

In this simulation, a computer program would be used to create a virtual representation of the brain and simulate the movement of electrical impulses along different pathways. This can help researchers and scientists study how the brain processes information and how different areas of the brain communicate with each other.

By using this computer model, scientists can observe the patterns and pathways of electrical activity in the brain, which can provide valuable insights into how the brain functions. This can help in understanding various neurological disorders and developing treatments for them.

I need the answer to this question A.Or B.OrC.Or D

Answers

The endosymbiotic theory states that some organelles in eukaryotic cells are original from prokaryotic microbes (bacteria), being mitochondria and chloroplast the example of the theory. Therefore, for the students demonstrate the endosymbiotic theory with the biological material that was offered to them they have to show the big bacteria ingesting the small one.

How many times more energy is produced by all three stages of cellular respiration than by glycolysis alone

Answers

The all three process of cellular respiration produces 18 times more ATP than glycolysis alone.

As there are 4 ATP produced in glycolysis from one molecule of glucose,2 from Krebs cycle, and rest 34 from electron transport chain.

These three process made total of 38 ATP

An organism is born with a genetic abnormality not present in any of its ancestors. This abnormality is most likely the result of?

Answers

Genetic diseases or abnormalities can be inherited or a result of a mutation, which is a change in the nucleotide sequence in the DNA of the organism.

Mutations can happen as a result of errors during mitosis or meiosis, as well as by damage from exposure to UV radiation or a chemical substance.

So, the right answer is mutation (option A)

what is a co factor ?give examples

Answers

Answer:

Cofactors are inorganic or small organic molecules that bind enzymes to enable or enhance their activity. Common inorganic cofactors are metals, including but not limited to magnesium, manganese, zinc, molybdenum, cobalt, and copper.

Explanation:

In what situation would the allelefrequency of a population NOT change?A. when individuals move into or out of an environmentB. when there is no evolutionC. when mutations create new allelesD. when individuals choose their mates

Answers

Answer

B. when there is no evolution

Explanation

The restriction enzyme EcoR1 recognizes the DNA sequence GAATTC. Which DNA strands will be cut by
EcoR1?
i. TTCAGGAATTCGGAAACC
AAGTCCTTAAGCCTTTGG
ii. TGAATCGAACCTG
ACTTAGCTTGGAC
iii. TTAAGCGGCCGAATTCAGTCCA
AATTCGCCCGCTTAAGTCAGGT
iv. CAGTAGGATTTCTGTGTC
GTCATCCTAAAGACACAG

Answers

EcoR1 creates 4 nucleotide sticky ends with 5' end overhangs of AATT.

These are the two options (i) and (iii) and the red marks indicate how the segment would be cut. So, the correct answer is option (iii)

Please give me brainliest

Endotherms are able to maintain a constant internal body temperature. Which is one property of endotherms that allows them to complete this task?A: well-developed lungs that deliver oxygen to the bloodB: a low metabolic rate that releases a small amount of heatC: an insulated body covering, such as fur or feathersD: a thin skin that readily absorbs heat from sunlight

Answers

The correct answer is the letter C: an insulated body covering, such as fur or feathers

Endotherms mainly use internally generated heat in order to maintain body temperature. This will cause their body temperature tends to stay steady regardless of the environment. On the other hand, ectotherms depend mainly on external heat sources and their body temperature changes with the temperature of the environment.

Examples of endotherms are birds and mammals

Examples of ectotherms are fishes, amphibians, reptiles, and invertebrates.

Ultraviolet light can be used to kill bacteria in food.TRUEFALSE

Answers

The correct answer is TRUE,

A ultraviolet light can kill bacteria in food the answer is true

What part of the reproductive system is highlighted in the picture attached? i don’t understand

Answers

The labeled part is URETHRA

The male urethra has a length of 18-22cm and it conveys urine from the urinary bladder to the exterior opening of perineum. It also provides an exit for the semen.

Signals from the sense organs are interpreted by the cerebrum, autonomic nervous system, medulla, cerebellum?

Answers

The correct answer is

Autonomic Nervous system

The nervous system is the command center of the organism's body. It interprets the messages it received from the sense organs. The brain is the control center of the nervous system. The cerebrum, medulla, and cerebellum are all parts of the brain.

The motor division of the Peripheral NervousSystem is divided into the....A. right motor division and left motor divisionB. fight division and flight divisionC. upper motor division and lower motor divisionD. somatic nervous system and autonomic nervous system

Answers

The peripheral nervous system transmits information between the central nervous system and the rest of the body. It is divided into two: the Somatic Nervous system, which receives and relays stimulus to the central nervous system, and the Autonomic Nervous system, which regulates the involuntary activities of the body.

ANSWER: D. somatic nervous system and autonomic nervous system

What kingdoms of life can have either sexual or asexual reproduction?Plantae, archaea, fungiAnimalia, plantae, and fungiPlantae, protista, and fungiEubacteria, protista, and fungi

Answers

We have to consider that sexual and asexual reproduction differs in that the first one requires both organisms, one male and one female, to produce genetically different offspring, while the second one requires only one organism to produce genetically identical offspring.

About the kind of organisms mentioned in the answer options, we can say Protista includes Fungi, so the answer options that include both of them can be excluded, mainly due to choosing one of those options would exclude other organisms that can be in fact sexual or asexual.

Having this clear, we can say that organisms such as those belonging to the Plantae, Fungi, and Animalia kingdoms can reproduce in these two ways (unlike Archaea, and Eubacteria).

In the pictures below we can see examples of organisms of these species that can reproduce both asexually and sexually. In them, we can see ants (which can produce eggs with only the genetic load of one parental organism), plants (which can reproduce through branches, but also through seeds), and fungi (which can reproduce also mitotically and meiotically), as in the second answer option.

Which dissolved substance do aquatic plants absorb from water during photosynthesis The choices are: carbon dioxide, ATP, oxygen, nitrogen

Answers

In the case of aquatic plants those that are totally submerged like seagrass, do photosynthesis as well as terrestrial plants, which need light carbon dioxide and expel oxygen. However, carbon dioxide in water dissolves so aquatic plants obtain it not in a gaseous way but in a dissolved way, so we can say that he correct answer is carbon dioxide.

In this process humans would select animals or plants with a trait they desire then breed those organisms to produce more individuals with the desired traits.Natural selectionContaminationInseminationArtificial selection.

Answers

The correct answer is Artificial selection.

Humans interfere in the natural process of organisms that they slect the desirable trait for the organisms that they think best will help the organisms to adapt well into their environment.

has warm temperatures and is dominated by grasses

Answers

Answer:

Grasslands (?)

Explanation:

You didn't give much context, but grasslands have warm temperatures and are generally dominated by grass--

Tropical grasslands have dry and wet seasons that remain warm all the time.

Temperate grasslands have cold winters and warm summers with some rain.

The most likely answer is tropical grasslands because they are warm all the time. (grasslands is a more open answer)

The digestive process involves two main types of digestion. Identify each one and explain how each works to break down food. Indicate where each type of digestion takes place in the body.

please help need to finish on Friday

Answers

The two types of digestion include the following below:

Mechanical digestion - This involves the use of physical methods and force to break down food such as in the mouth.Chemical digestion  - This involves enzymatic action to break food down such as in the stomach.

What is Digestion?

This is referred to as the process in which food is broken down into smaller substances so as to be acted on by enzymes and assimilated into the bloodstream for the optimal functioning of the body.

Mechanical digestion happens in the mouth and it involves processes such as chewing while chemical digestion involves the breakdown of food through enzymatic actions.

Read more about Digestion here https://brainly.com/question/21470803

#SPJ1

Is the trait (blue) in the pedigree most likely caused by the presence of a dominant or recessive allele?Group of answer choicesrecessivedominantneitherboth

Answers

The blue trait is most likely caused by a dominant allele (e.g. allele A), while the white trait is caused by a recessive allele (allele a). However, for the diagram to be correct, individuals 1I and 2I must have genotypes Aa (blue) and aa (white) respectively, thus making the punnet squares, the genotypes of their offspring would be Aa (blue) and aa (white). In turn, we can verify that this is correct by observing the third generation since if the blue individuals of the second generation had genotype AA, they could not have white offspring (aa). If we make all the crosses, the genotypes would be as follows:

1 I: Aa 2 I: aa

1 II: Aa 2 II: aa 3 II: aa 4 II: aa 5 II: Aa 6 II: aa 7 II: Aa 8 II: Aa

1 III: Aa 2 III: aa 3 III: aa 4 III: aa 5 III: aa 6 III: Aa or AA 7 III: aa 8 III: Aa or AA 9 III: aa

What blood types are possible for a child whose parents both have AB bloodtype?I. AII. BIll. ABIV. OA. Only IB. Ill and IVC. I and IlD. I, Il, and Ill

Answers

They are asking us the possible blood types for a child of parents with AB blood type.

This means that both parents have one allele for antigen A (Iᵃ) and one allele for antigen B (IᵃIᵇ):

Mother: IᵃIᵇ

Father: IᵃIᵇ

Just from that, the child cannot be type O, because there is no allele for not having any antigen (i).

Let's look at the Punnet's square:

As we can see, the child of this couple could have blood type A, B, or AB.

This means the right answer is D. I, Il, and Ill

2. Sickle Cell Anemia is inherited as an autosomal recessive trait. What would be
the chances of a non-carrier female and a man with sickle cell anemia having
afflicted children?
a) Assign Symbols
b) Show the cross
c) Punnett square
d) Genotypic ratio
e) Phenotypic Ratio

Answers

The chances of a non-carrier female and a man with sickle cell anemia having afflicted children would be 25%.

What is anemia?
When you have anaemia, your body does not create enough healthy red blood cells to supply your tissues with just enough oxygen. Being anaemic, or having low haemoglobin levels, can make you feel tired and fragile. Anemia can manifest itself in a variety of ways, each with its own set of causes. Anemia can be minor to severe, and it can be short-term or long-term. Anemia is often caused by a combination of factors. Consult a doctor if you suspect you have anaemia. It could be an indication of a serious sickness. Treatments for anaemia can range from taking vitamins to seeking medical help, depending on the underlying cause. A balanced, diverse diet may help you avoid some types of anaemia.

To learn more about anemia
https://brainly.com/question/8197071
#SPJ1

QUESTION 17Which of the following best describes the definition of a gene?A collection of polypeptides that fold to form a complex proteinGenetic information that produces a product, either proteins or RNAThe protein product that genetic material producesA section of DNA that produces a single protein product

Answers

As we know a gene is the minimal functional part of DNA and code for different traits, these can be proteins, RNA, or other type of regulators, so we can say that the correct option is the number 2

32. Which substance plays a central role as an energy source in humans and ascellulose in plants?A. fatsB. proteinsC. carbohydrates

Answers

Explanation:

The main energy source in humans is glucose, which is a monosaccharide. Through cellular respiration, ATP is produced from glucose. ATP is the energy currency of biochemical reactions in the human body. On the other hand, a polymer of this monosaccharide (beta glucose) is cellulose, which is found in plants as part of their cell wall.

We can conclude that the correct answer is:

Answer:

C. carbohydrates

Which of the following describes organisms that need to obtain energy from other organisms?Select all that apply.A. heterotrophsB. autotrophsC. consumersD. producers

Answers

Explanation:

Remember that by definition, a heterotroph is an organism that cannot make its own food, but instead obtains its food by consuming other organisms. That is, a heterotroph is an organism that eats other organisms (plants or animals) for energy and nutrients. For this reason, heterotrophs are considered consumers.

We can conclude that the correct answer is:

Answer:

The correct answers are:

A. heterotrophs

C. consumers

Would the absence of the nucleolus affect the process of protein synthesis? Explain

(HELP NEEDED BY THE NEXT FEW HOURS. THANK U SO MUCH)

Answers

The absence of nucleolus will affect the process of protein synthesis because r-RNA is required for protein formation and the synthesis of r-RNA occurs in the nucleolus.

Nucleolus is a small dense structure present inside the nucleus. It is site for r-RNA synthesis. Ribosome assembly also takes place inside the nucleolus. Nucleolus is also known to play part during cell's response to stress.

r-RNA is the ribosomal RNA. It is involved in the formation of ribosome along with some proteins. Ribosome is the most essential machinery for the synthesis of proteins. r-RNA belongs to the category of non-coding RNAs. r-RNA is considered to be a ribozyme.

To know more about r-RNA, here

brainly.com/question/13868647

#SPJ1

bones will usually heal after they have been severely damaged so long as the cellular components of the endosteum and periosteum survive and there is a(n)

Answers

Answer:

ossification Center

Explanation:

The diagram shows a cross between a plant with white flowers and a plant with red flowers.The offspring is a plant with pink flowers.Which pattern of inheritance is shown?

Answers

Answer: Incomplete Dominance

Explanation:

Incomplete dominance is described by a phenotype that is not completely dominant over another. Therefore, it will be a "blending" of colors in the case of this question, therefore the petals are pink.

May I get help with number two and with a punnets square

Answers

The hemophilia gene is an X-linked recessive gene. This means that a person will be hemophiliac if has two copies of the recessive "h" allele (in the case of females) or if has one copy (in the case of males). This also means that if the individual possesses the dominant H allele, he or she will not have hemophilia. Therefore, when performing the punnet table of section 2, we can observe that only one of four descendants would present hemophilia and in this case, it would be a male with genotype X^h Y (25% male), and only one of four would be a carrier that doesn't present hemophilia and in this case, it would be a woman with genotype X^H X^h (25% female)

Is my response to this good is there anything I can change or add to make it better? You now know what an ecosystem is—and how varied ecosystems can be. Pick an ecosystem near you—find one that it as large or small as you wish. All areas—urban, suburban, and rural—have many ecosystems to choose from. Write a description of the ecosystem, including biotic and abiotic factors, in NO MORE THAN FOUR SENTENCES.An ecosystem close to me is a river. Abiotic factors: High water quality and the water is very clear. The average water temperature is 55F, and the water gets a lot of sunlight. Biotic factors: There are many different types of fish, such as bull trout and salmon. Many different kinds of frogs live in and along the edges of the river, and various kinds of plants and algae.

Answers

River ecosystem is also referred to as lotic ecosystem. Important descriptions of a river ecosystem includes the temperature, flow of water, floods, sediment transport, river bed features, and structure of habitat. It can also include the geographical area. Biotic factors can include the other plants and animals around the river including the land and aerial animals. Abiotic factors can also include substrate and composition aside from the temperature and light factors you already mentioned.

Write the balanced equations for the process of your organism uses to make food / energy ( Photosynthesis , respiration, or both).My organism is great white shark

Answers

Photosynthesis is a mechanism of sugar production that is carried out by plant organisms possessing chloroplasts. Most animals cannot perform photosynthesis because they do not have chloroplasts, the great white shark is one of them.

On the other hand, respiration is a mechanism for obtaining energy that is performed by all organisms, which can be aerobic (in the presence of oxygen) or anaerobic (in the absence of oxygen). In cellular respiration, sugars such as glucose are metabolized to obtain energy.

The equation changes depending on the type of breathing that is performed, but in this case, the white shark performs aerobic breathing, so the equation would be:

Answer:

Photosynthesis is a sugar-production mechanism carried out by plant organisms possessing chloroplasts. Most animals cannot perform photosynthesis because they do not have chloroplasts, the great white shark is one of them.

On the other hand, respiration is a mechanism for obtaining energy performed by all organisms, which can be aerobic (in the presence of oxygen) or anaerobic (in the absence of oxygen). In cellular respiration, sugars such as glucose are metabolized to obtain energy.

The equation changes depending on the breathing that is performed, but in this case, the white shark performs aerobic breathing, so the equation would be:

Explanation:

How do trees give earth all its oxygen?

Answers

*Oxygen is an essential element in the atmosphere that helps living organisms stay alive.

*Tress gives Earth oxygen through the process of photosynthesis. Plants, such as trees, capture sunlight and use it to split carbon dioxide and water. The product of it is sugar which releases oxygen into the atmosphere as a by-product of the process.

Other Questions
Multiply 1.42 x 0.3 Solve for h.A=3h Can anyone help me? What value is a discontinuity of x^2+5x+2/x^2+2x-35 Find the equation of the line using the given information and the point slope form. Express the equation in slope intercept form points (5,6) Points(-1,4) You have $5,000 to invest and want it to grow to $20,000 in two years. What interest rate would you need to find to make this possible?I wan answer and explanation. what title did Mitchell Palmer hold during the 1920sA. Vice presidentB. President C. secretary of the state D. Attorney general Americans said money mistakes cost them $1,230, on average, last year alone, According to U.S. Census Bureau data from 2018, the latest release, the median household income was $61,372. What percent of their income did they lose on mistakes? Thegas/oil ratio for a certain chainsaw is 50 to 1.a. How much oil(in gallons) should be mixed with 13 gallons ofgasoline? b. If 1 gallon equals 128 fluidounces, write the answer to part a in fluid ounces. Solve the given equation over the interval [0,2%): 3 tan x+tan x = 0.7%x= 0 and x= - and x=6.6x= 0 and x=76and x=11%657 119x= 0 and x= and x=66es andSTx= 0 and x= - and x =6od x = F and = Which of the following is a measure of the amount of space that an object occupies?MassVolumeDensityWeight What is the basic premise of berkoves argument ? What is the basic premise of wangs argument ? In the story of an hour 6 I need a Introduction for hypertension Pulmonary edema and impaired ventilation occur during? A. septic shock. B. neurogenic shock. C. cardiogenic shock. D. anaphylactic shock. Translate to an algebraic expression, but do not simplify.the difference of 10 and -16Simplify the translated phrase if possible. Sam makes $11.78 working at Salata. He works 32 hours a week.Calculate his net salary after deducting 6.2% or (0.062) for Social Security deduction and 2.9% or (0.029) for Medicare deduction. What is his net pay? Solve for x. 4x-39>-43 and 8x+31 Write a quadratic equation with 7 and 2/5 as its roots. Write the equation in the form ax2 + bx+c= 0, where a, b, and c are integers. can someone please help?just in case if the picture seems blurry, the question says the take off ramp is parallel to the waiting ramp, and the interest ramps are parallel. Given that the measure of angle a is 88 find the measure of each remaining angles if flies that are heterozygous for all three traits are crossed, what proportion of the offspring would you expect to be heterozygous for all three traits?