this virulence factor is common to many members of the enterobacteriaceae and it allows them to inject proteins directly into the host cell: group of answer choices porins. pili. type iii secretion system. fimbriae. a glycocalyx.

Answers

Answer 1

Many species of the enterobacteriaceae share the type iii secretion system, which enables them to inject proteins right into the host cell.

What characteristics make Enterobacteriaceae virulent?

The Enterobacteriaceae antigenic structures, the O, H, and K antigens, and the polysaccharide capsules are additional defined bacterial virulence factors. Less research has been done on the virulence factors important for urinary tract infections in Gram-positive pathogens.

What constitutes E. coli's primary virulence factors?

We may categorize E. coli pathotypes into four primary virulence classes: colonization, fitness, toxins, and effectors; each is composed of a number of distinct virulence factors with a clear purpose and activity (Table 1). It's important to highlight that several enteric and extraintestinal pathotypes of E.

To know more about enterobacteriaceae visit:-

https://brainly.com/question/14781702

#SPJ4


Related Questions

In the experiment described in the animation, why did the investigators add a mutagen to the culture medium?.

Answers

In the experiment described in the tutorial, the investigators add a mutagen to the culture medium to increase the rate of evolutionary change in the viruses.

What is mutagen?

Any factor that results in a mutation (a change in the DNA of a cell). Mutagens can injure cells and cause some diseases, like cancer, by altering DNA. Radioactive elements, x-rays, ultraviolet rays, and certain compounds are examples of mutagens.

What is a virus?

A virus is an infectious microorganism made up of a protein-coated segment of nucleic acid (either DNA or RNA). A virus can't multiply by itself; it has to infect cells in order to utilize the host cell's components to make copies of itself. Viruses are composed of bundles of DNA or RNA that are encased in a protein capsule called a capsid. Infectious agents that are acellular and must exist in the presence of a host cell in order to grow, viruses are frequently referred to as obligatory intracellular parasites. All cell types, including those in people, animals, plants, bacteria, yeast, archaea, and protozoa, have been proven to be susceptible to certain viruses.

Thus from above conclusion we can say that in the experiment described in the tutorial, the investigators add a mutagen to the culture medium to increase the rate of evolutionary change in the viruses.

Learn more about the virus here:

https://brainly.com/question/25236237

#SPJ1

A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write the mRNA that would be transcribed from this DNA fragment.b) Circle the starter and the stopper in your mRNA sequence. Write the sequence of amino acids which would be encoded in translation. Use the mRNA codon table provided.c) Where in the cell do transcription and translation occur?

Answers

a) In order to transcribe the segment of DNA, it is important to note that this process is important for gene expression as a protein. An enzyme called RNA polymerase moves along the DNA until the end of the gene, releasing the mRNA. The DNA has two strands: one that goes from 5' to 3' direction, and another one that goes from 3' to 5' direction. The one that's used for transcription will always be the 3' to 5' one, so we already have the correct strand to work with, as it is a 3' to 5' strand.

However, the mRNA will be assembled in the 5' to 3' direction. Using the same complementary base-pairing rules as in DNA, we will pair Cytosine (C) with Guanine (G), but as there is no Thymine (T) in RNA, we will pair Adenine (A) with Uracil (U).

Therefore, the sequence o mRNA read in the 5' to 3' direction is:

5' CUAUGGAAACACAUCAGUAGAA 3'

b) The starter codon is the AUG codon of a messenger RNA (mRNA). Therefore, the sequence of amino acids will start to be decoded there.

The stopper codon can be one of the three following options: UAA, UAG or UGA. In this case, we can only find the UAG codon.

The codons, then will be:

AUG GAA ACA CAU CAG UAG

Then, we can say that the amino acids translated will be:

Met Glu Thr His Gln

(Methionine - Glutamine - Threonine - Histidine - Glutamine

c) In eukaryotes, transcription occurs inside the nucleus of the cell and translation occurs in the cytoplasm.

Given that propane has hydrogen in it, do you think that carbon dioxide could be the only product from the burning of propane? Why or why not?

Answers

No. Carbon dioxide cannot be the only product of the burning of propane. Water is also produced.

Combustion of hydrocarbons

Generally, hydrocarbons undergo combustion reactions with oxygen. When this happens, complete combustion leads to the production of carbon dioxide and water.

The general equation for the combustion of hydrocarbons is written as: [tex]C_nH_{2n+2} + (3n+1)/2 O_2 = n CO_2 + (n+1) H_2O[/tex]

Propane is a hydrocarbon with the chemical formula, [tex]C_3H_8[/tex]. Thus, when it burns in oxygen, the equation of the reaction becomes:

[tex]C_3H_8 + 5O_2 -- > 3CO_2 + 4H_2O[/tex]

From this equation, we can see that not only carbon dioxide is produced when propane burns in oxygen, but water molecules as well.

Thus, carbon dioxide cannot be the only product of propane combustion because another product, water, is also formed.

More on propane combustion can be found here: https://brainly.com/question/3014094

#SPJ1

which one could produce a sperm with two x chromosomes: nondisjunction during meiosis 1 or nondisjunction during meiosis 2?

Answers

Nondisjunction during meiosis 2 could produce a sperm with two x chromosomes.

Nondisjunction can occur during meiosis I and meiosis II, resulting in an abnormal gamete chromosome number. The main difference between meiosis 1 and meiosis 2 nondisjunction is that meiosis 1 does not separate homologous chromosomes, whereas meiosis II does not separate sister chromatids.

Nondisjunction means that the pair of homologous chromosomes did not separate or did not separate at anaphase so that both chromosomes of the pair end up in the same daughter cell. This probably occurs most frequently in meiosis, but can occur in mitosis to create mosaic individuals.

Meiotic nondisjunction can result in pregnancy loss or the birth of children with extra chromosomes in every cell, whereas mitotic nondisjunction results in mosaicism of two or more cell lineages. Aneuploidy can also result from late delay.

Learn more about meiosis from:

https://brainly.com/question/29383386

#SPJ4

Volume can be measured in liters or cubic meters.
Please select the best answer from the choices provided
OT
OF

Answers

Answer:

The correct answer option is True.

Explanation:

Volume can be measured in liters or cubic meters - it is true.

The measure of the amount of space which an object or a substance can occupy is said to be its volume.

The basic unit of volume in the metric system is a liter while the SI unit of the volume is the cubic meter.

Therefore, the given statement is true.

What are some possible components of the pus found in the middle ear? how does this produce the redness of the eardrum? how does this relate to fever?.

Answers

Fluid buildup in the middle ear can be caused by swollen eustachian tubes.

Pus is an indication of infection. Pus after surgery indicates a post-operative complication in the form of an infection. People who notice a pus discharge after surgery should contact their doctor right away.

Depending on the cause of your infection, antibiotics or antifungal medication may be required. For temporary relief, your doctor may also prescribe pain medication. It is not recommended that you soak your ear, swim, or use ear plugs or earbud headphones while treating this infection.

Abscesses, if left untreated, can cause an infection that spreads throughout your body and can be fatal.

To learn more about ear infections, here

https://brainly.com/question/3897351

#SPJ4

What factor determines when an animal species will enter an ecosystem insuccession?A. Food availabilityB. PioneersC. CompetitionD. Minerals

Answers

Ecology: Ecological succession

Ecological succession is the process of change in the species present in an ecosystem over time.

There are two types of succession:

• Primary succession,, where an area that hasn't had any life before begins to be colonized, such as a new island.

,

• Secondary succession,, where there is a disturbance, such as a fire, that removes the organisms living in that area.

The changes in plants depend on changes in the soil and interactions with other organisms, such as competition for light with other plants and feeding from herbivores.

On the other hand, the changes in animals depend on sources of food and predation interactions.

This means the correct answer would be A. Food availability.

what does atg in the liam/elijah coding sequence of dna correspond to in the mrna and resulting amino acid chain? what does tac in the leah/jenny template sequence of dna correspond to in the mrna and resulting amino acid chain?

Answers

The atg in the liam/elijah coding sequence of DNA correspond to in the mrna and results into Elijah: UAU, UCU, CAA, CCC, GAU and liam: UGU,UCA, UAA, CCU, GAG.

What is coding sequence and amino acid chain and what does tac in the template sequence correspond to?Coding sequence is a sequence of DNA which codes for a particular character and even this is sequence which proceed further in the generation.There are non coding sequences also which are excised later in the process by removal enzymes and the coding sequences are proceeded further for the process.Here the question is asked of the atg in the liam/elijah who are brothers and the coding sequence of DNA correspond to in mRNA and resulting amino acid chain too and the tac in the DNA template too.Well the resulting amino acid chain in would be Elijah: UAU-UCU-CAA-CCC-GAU and the amino acid sequence in Liam would be UGU-UCA-UAA-CCU-GAG.Hence the amino acid sequence in the two brothers are so as mentioned in the point above and the amino acid sequence is initial progenitor for the mRNA processing.

To know more about mRNA visit:

https://brainly.com/question/12903143

#SPJ4

What are the 2 types of cells????

Answers

Answer:

The two types of cells are prokaryotic and eukaryotic.

Answer:

Prokaryote and Eukaryote Cells

Explanation:

What is a Prokaryote Cell?

A prokaryote cell is a cell which has no nucleus or membrane-bound organelles.

What is an Eukaryote Cell?

A Eukaryote cell is a cell which has a nucleus and membrane-bound nucleus.

What's a chart to help you identity cells.

Scientist use a dichotomous key to determine scientific names of things and it helps determine which cell is which.

To learn more about Prokaryote and Eukaryote Cells visit

https://brainly.com/question/6871687

To learn more about dichotomous keys visit

https://brainly.com/question/16333970?referrer=searchResults

two (2) ways in which octopuses are considered one of the most intelligent animals that exist in our world today.

Answers

Some ways in which octopuses have shown their intelligence in labs has been by completing various maze and opening tricky traps to acquire food rewards.

Octopuses are deep sea creatures who are well known for their 8 suction cups lined limbs along with their bulbous head and ink-secreting mechanism.

Of all the invertebrates octopuses are considered to be the most intelligent creatures.

They have a complex system of neurons that together act as a brain. This allows the octopus to perform various tasks such as touching animals and manipulating its surroundings or smell.

Apart from this all of the octopus's 8 arms can be moved independently from each other.

Some ways in which octopuses have shown their intelligence in labs has been by completing various maze and opening tricky traps to acquire food rewards.

Learn more about octopuses at:

brainly.com/question/26814725

Explain how used the fossil, rock and glacier evidence to help you form Pangaea

Answers

Answer:

Glacial deposits are glacial landforms developed by big rocks collected in the landscape region due to the withdrawal of glaciers.

Explanation:

Why is the era of nucleosynthesis so important in determining the chemical composition of the universe?.

Answers

The nucleosynthesis era is significant because it is when the nuclear fusion process produced all of the primordial hydrogen and helium.

Why is the nucleosynthesis era crucial for understanding the universe's chemical makeup?

The chemical makeup of the universe is the same today as it was at the end of the nucleosynthesis epoch, with the exception of a minuscule quantity of matter created subsequently by stars.

Why is nucleosynthesis important? What is it?

The process of creating new atomic nuclei—the protons and neutrons that make up an atom's center—is known as nucleosynthesis. Within a few minutes after the Big Bang, the process of nucleosynthesis began. At that time, a soup of quarks and gluons known as a quark-gluon plasma condensed into neutron and proton.

To know more about nucleosynthesis visit:-

https://brainly.com/question/14123267

#SPJ4

Which molecule is most common in the human body?
A. H₂
B. N₂
C. H₂0
D. CO₂

Answers

Answer:

c) H₂0

Explanation:

H₂0 molecule (water) is the most common molecule in the human body. Hence, option (c) is the correct answer.

Yeast is a unicellular organism that undergoes fermentation, a type of anaerobic respiration, to convert sugar into alcohol and carbon dioxide. In an experiment testing yeast activity, Sakurapoured equal amounts of warm water into two bowls. She added 1 teaspoon of sugar to only one bowl. Next, she added 1 teaspoon of yeast to each bowl. Within a few minutes, bubblesstarted to rise to the top of both bowls. Which of the following best explains why Sakura observed more bubbles produced in the bowl with sugar than in the bowl without sugar?A.Sugar provided the chemical energy for driving photosynthesis, resulting in greater production of oxygen bubbles.B.Sugar provided the light energy for driving cellular respiration, resulting in greater production of oxygen bubbles.C.Sugar provided the light energy for driving photosynthesis, resulting in greater production of carbon diaxide bubbles.D.Sugar provided the chemical energy for driving cellular respiration, resulting in greater production of carbon dioxide bubbles.

Answers

The correct answer is D. Sugar provided the chemical energy for driving cellular respiration, resulting in greater production of carbon dioxide bubbles. Sugar is a chemical used by heterotrophic organisms to perform cellular respiration, which ultimate product is carbon dioxide (CO2).

Sensing systems incorporated into harvesting machines that register and record amounts of harvests associated with specific portions of a planted field are called monitoring systems.

Answers

Crop monitoring makes use of space-based data to keep tabs on crop development and forecast crop yields for certain fields that have been planted.

What is monitoring systems?

A system for monitoring agriculture consists of a network with wireless sensors. These sensors gather information from several nodes positioned on the playing surface. Then, specialists or nearby farmers analyze this data. The data can be used to make a number of inferences about weather patterns, soil fertility, crop quality, etc. A system is developed for agricultural field monitoring in IoT-based modern agriculture with the aid of sensor like light, humid, temperatures, soil moisture, etc. Farmers may monitor the condition of thier fields from any location. IoT-based smart farming is considerably more efficient than conventional farming.

How do farmers monitor their crops?

Nowadays, satellite techniques are widely employed in agriculture, and many farmers use them frequently to observe their fields and assess the condition of their crops. Crop monitoring is crucial for managing various pests, weeds, and diseases that affect crops. This gives information about the crop's current situation, and you can then look ahead in time to forecast what will probably be the crop's next problem.

To know more about Monitoring Systems visit:

https://brainly.com/question/28776835

#SPJ1

you have identified a receptor in a pathway that you are studying. the next relay protein in the pathway is phosphorylated on a tyrosine to activate it. how can you determine if the receptor is a rtk or a tk-associated receptor?

Answers

Typically, the receptor kinase protein has a transmembrane domain. The non-receptor tyrosine kinase, though, lacks a transmembrane domain.

What distinguishes receptor tyrosine kinases from G protein-coupled receptors?

The main distinction between receptor tyrosine kinases and G protein coupled receptors is that the former can only cause one cell response from a single ligand binding, whereas the latter can cause multiple cell responses from a single ligand binding.

A RTK, is HER2?

As a transmembrane RTK, HER2 is activated upon dimerization with another receptor from the epidermal growth factor family, such as EGFR (ERBB1), ERBB3 (HER3), and ERBB4 (HER4).

To know more about receptor visit:-https://brainly.com/question/29343237

#SPJ4

Match the terms regarding the subhylum Vertebrata to their correct phase of definition.

Answers

• Axial Skeleton,: A division of the skeleton consisting of the skull, thoraz and vertebral column

,

• Appendicular Skeleton,: A division of the skeleton composed of the girdle and limb bones

,

• Oviparous,: These organisms lay eggs that develop and hatch outside the mother.

,

• Viviporous,: These organisms nourish their offspring inside the mother during development and give birth to live young.

,

• Ovoviviparous,: These organisms carry their young in eggs inside the mother, when the eggs hatch, the mother gives birth to live young.

all fuels are sources of energy​

Answers

Answer:

they are usually considered to be a primary energy source.

Explanation:

Provide examples of other organisms if possible that belong to the same kingdom?

the organism is a dog

Answers

Answer:

All Animals are part of this kingdom

Humans

Cow

Cat

Horse

Donkey

Tiger

Lion

Panther

Leopard

Cheetah

Bear

Elephant

Polar bear

Turtle

Tortoise

Crocodile

Rabbit

Porcupine

Hare

Hen

Pigeon

Albatross

Crow

Fish

Dolphin

Frog

Whale

Alligator

Eagle

Flying squirrel

Ostrich

Fox

Goat

Jackal

Emu

Armadillo

Eel

Goose

Arctic fox

Wolf

Beagle

Gorilla

Chimpanzee

Monkey

Beaver

Orangutan

6. Analyze How can the introduction of nutria affect a pond ecosystem food web?

Answers

The introduction of nutria affects a pond ecosystem food web because the saltwater marshes are destroyed by Nutria's ravenous eating habits.

Nutria's ravenous appetite for food causes the destruction of saltwater marshes, which reduces the amount of food and shelter available to other species and promotes severe erosion.

By devouring the wetland grasses, Nutria devastates the area's food chain and environment. A few invasive species seriously hurt the economy. The amount of above- and below-ground plant matter that nutria consume daily can reach up to 25% of their body weight.

Nutria obliterates the banks of ditches, lakes, and other bodies of water in addition to harming vegetation and agriculture. What's most important, though, is the long-term harm that nutria may do to wetlands like marshes.

To learn more about Nutria visit: https://brainly.com/question/17690670

#SPJ9

5 functions of mesophyte​

Answers

Answer: Find your 5

Explanation:

Mesophytes generally require a more or less continuous water supply. They usually have larger, thinner leaves compared to xerophytes, sometimes with a greater number of stomata on the undersides of leaves. Because of their lack of particular xeromorphic adaptations, when they are exposed to extreme conditions they lose water rapidly, and are not tolerant of drought. Mesophytes are intermediate in water use and needs. These plants are found in average conditions of temperature and moisture and grow in soil that has no water logging. The roots of mesophytes are well developed, branched and provided with a root cap. The shoot system is well organised. The stem is generally aerial, branched, straight, thick and hard. Leaves are thin, broad in middle, dark green and of variable shape and measurement.[citation needed]For example, in hot weather they may overheat and suffer from temperature stress. They have no specific adaptations to overcome this, but, if there is enough water in the soil to allow this, they can increase their rate of transpiration by opening their stomata, thus meaning some heat is removed by the evaporating water. However these plants can only tolerate saturated soil for a certain amount of time without a warm temperature. In dry weather they may suffer from water stress (losing more water via transpiration than can be gained from the soil). Again they have no specific adaptations to overcome this, and can only respond by closing their stomata to prevent further transpiration. This does actually have some benefits as it reduces the surface area of the leaves exposed to the atmosphere, which reduces transpiration. Prolonged periods of dehydration, however, can lead to permanent wilting, cell plasmolysis, and subsequent death. Since mesophytes prefer moist, well drained soils, most crops are mesophytes. Some examples are corn (maize), cucurbits, privet, lilac, goldenrod, clover, and oxeye daisy

39. Mice only store a small amount of energy from the the plants they eat. State what might happen to some ofthe remaining energy they obtain from their food.

Answers

The mice stores part of the energy from food and utilize the rest in their daily life activities. Some of the energy is stored in the form of fat for the mice have a better control of the exchanges of temperature with the environment, other part of this energy is used to make the systems in the mice body work (cells, tissues, and all the structures of the mice body). The energy from food is in the form of macromolecules that are cleaved in smaller molecules and nutrients that will be used for the process of making all components of the body works. Even the small amount of energy that is stored needs to be comcompartimentalized, and for that the mice use the energy "to spend". To the living organisms food energy is a essential need, because without disponible energy the organism can not work properly.

List 3 other species that would be in the same trophic level as the warthog

Answers

A lion, a crocodile, and a wild dog.

select the features that would be compared. select all that apply. select the features that would be compared.select all that apply. photosynthetic pigments cytological features aspects of physiology type of motion type of nutrition morphological traits

Answers

Cytological features can be compared. Cytological analysis focused on both cytomorphological architecture and individual nuclear functions.

What is the cytological method?

Cytological techniques are methods used to study or manipulate cells. It includes methods used in cell biology to culture, track, phenotype, sort, and screen cells within populations or tissues, and molecular methods for understanding cell function. increase.

What is cell biology and why is it called cytology? A branch of biology concerned with structure, function, proliferation, pathology, and life history of cell is called cell biology or cytology.The field cytology was founded in 1928 by George Nicholas Papanicolaou. Cytopathology is generally applied to samples of free cells or tissue fragments, in contrast to histopathology, which examines whole tissue. Cytopathology is often called, less precisely, "cytology," which means "study of cells."

To learn more about cytology visit:

https://brainly.com/question/10865552

#SPJ4

a particular small noncoding rna that is linked to spermatogenesis is most likely classified as what kind of noncoding rna?

Answers

The correct option is D : piwi-interacting RNAs . Animal gametogenesis and fertility are greatly influenced by PIWI-interacting RNAs (piRNAs), which also suppress transposons, fight viruses, and regulate endogenous genes1.

Animals' PIWI-interacting RNAs (piRNAs), which range in length from 21 to 35 nucleotides, suppress transposable elements, control gene expression, and thwart viral infection. PiRNAs direct the PIWI proteins to cleave the target RNA, encourage the construction of heterochromatin, and methylate DNA. The piRNA pathway's architecture enables it to control conserved host genes in addition to providing adaptive, sequence-based immunity to transposons and viruses that are continually developing. While somatic piRNA activities have been lost, gained, and lost again during evolution, piRNAs silence transposons in the germ lines of the majority of mammals.

Learn more about to noncoding rna visit here:

https://brainly.com/question/15943629

#SPJ4

Full Question ;

A particular small noncoding RNA that is linked to spermatogenesis is most likely classified as what kind of

noncoding RNA?

A) short interfering RNAs

B) bidirectional lncRNAs

C) microRNAs

D) piwi-interacting RNAs

what are the characteristic features of the arthropods? what are the advantages and disadvantages of these features

Answers

Main characteristic features of the arthropods is that their exoskeleton is made of chitin and circulatory system is open.

Characteristics:

The body is trigerminated, segmented, and bilaterally symmetrical.They show the tissue level of the organ system.The body is divided into head, thorax and abdomen.Their bodies have articulated appendages that help them move.The body cavity is filled with blood.Terrestrial arthropods secrete from the malpighian tubules, whereas aquatic arthropods secrete from green or coaxial glands.They are unisexual and fertilization is either external or internal.They have a well-developed digestive system.Breathe through the general body surface or trachea.

Advantage:

Arthropods are layers of wax that prevent dehydration and prevent the body from drying out

Disadvantage:

The exoskeleton cannot grow. As the animal grows, it must molt or molt the exoskeleton and wait for the underlying new exoskeleton to harden.

Learn more about arthropods from:

https://brainly.com/question/2244172

#SPJ4

18. As part of an experiment, a light source is placed next to a plant. After a few days, the plant is growing toward
the light. The light acted as a(n)..
a. stimulus
b. response
c. growth
d. defense

Answers

Answer:

The answer is A, stimulus

Define polar molecule or polarity.This is not a test question, could you please simplify the response to as few sentences as possible?

Answers

Polarity is caused by electronegativity. Electronegativity is the ability of an atom to attract electrons and when in a molecule there is a region of low electronegativity and a region of high electronegativity we say that the molecule is polar.

compare the wave shape of an alligator’s low-frequency mating call with the wave shape of a frog’s high-frequency chorus. How are the shapes different

Answers

The comparison of the wave shape of an alligator’s low-frequency mating call with the wave shape of a frog’s high-frequency chorus in the way that their shapes are different is that The high-frequency shapes are relatively close together whereas the low-frequency waves are spaced out.

What is the mating call about?

American alligators aren't afraid to make their presence known when they're looking for a mate, and the outcome might sound like a cross between a motorcycle and the loudest snorer ever. An image of a huge male making one of its loud grunting mating sounds is captured on camera.

So, Odorrana tormota and Huia cavitympanum are two species of frogs that are currently recognized for their ability to vocalize at high frequencies, or even partially ultrasonically. Both individuals' hearing systems have been specially modified so they can hear in the high-frequency band.

Therefore, While the high-frequency patterns are closely spaced apart, the low-frequency waves are elongated in both animals.

Learn more about low-frequency from

https://brainly.com/question/21890312

#SPJ1

Asbestos fibers cause a cancer called mesothelioma in humans. The fibers kill cells that line lung tissue by causing programmed-cell death. When cells die this way, they release a chemical, HMG1, which causes an inflammatory response in other cells. During this inflammatory response, cells release chemicals that promote tumor growth. What conclusion can you draw about the chemicals released in the inflammatory response? A. They decrease the amount of HMG1 in a feedback loop. B. They increase the amount of HMG1 in a feedback loop. C. They disrupt the normal circadian rhythms. D. They disrupt the normal cell cycle.

Answers

The conclusion that we can draw about the chemicals released in the inflammatory response is that HMG1 acts as a mediator of acute lung inflammation might leads to lung cancer, such as mesothelioma. The presence of HMG1 causes cells to release certain chemicals that promote tumor growth.

What is Asbestos Fibers and Mesothelioma?

Asbestos has a crystalline category of naturally occurring silicate fibers. These fibers are only visible under a microscope. Asbestos harms lung tissue cells by inducing programmed cell death.

When cells die in this way, they produce HMG1 (high mobility group proteins that promotes an  in other cells. The presence of HMG1 causes cells to release certain chemicals that inflammatory reactionpromote tumor growth.

Therefore, The presence of HMG1 causes cells to release certain chemicals that promote tumor growth.

Learn more about tumor on:

https://brainly.com/question/12020868

#SPJ1

Other Questions
determine the composition of transformation that would map figure ABCD to figure A"B"C"D". 1. the transformation that would map vertex B to B' isa: a transformation down and rightb: a rotation of 90 about Bc: a rotation of 360 about B Carlos works a total of 86 hours in four weeks. He works 18.5 hours each week for three weeks. How many hours does Carlos work in the fourth week? Can you help me figure out if figure in a polygon. is it a polygon the name of it by the number of the size Give 2 ways to distinguish between carbon(iv) oxide and carbon (ii) oxidedifferentiate the physical properties of the two oxides of carbon The passage from The Namesake and the poem In a Garden both use vivid imagery to convey strong feelings. Write an essay in which you analyze the images in each work and the feelings they convey. Then, tell which author you think did a better job of effectively using imagery as a tool todevelop her text. Be sure to use details from both sources to support your analysis. Given the pre-image coordinates (0, 5), (-3, 2), (4, -1) and transformed image coordinates (2, -5), (-1, -2), (6, 1), what is the coordinate transformation in function notation? The monthly cost (in dollars) of a long-distance phone plan is a linear function of the total calling time (in minutes). The monthly cost for 37 minutes of calls is$13.21 and the monthly cost for 70 minutes is $17.50. What is the monthly cost for 45 minutes of calls? Emma drew 11 hearts and 20 cycles.What is the ratio of circles to hearts in simplified form? A group of 6 students was asked, "How many hours did you watch television last week?" Here are their responses.11, 11, 4, 9, 10, 17Find the mean number of hours for these students.If necessary, round your answer to the nearest tenth.hours Find the measure of angle R, given that the largest triangle is a right triangle.A)27B)18C)72D)45 The number of accidents that occureach day at a certain intersection alongwith the corresponding probabilities areshown.Accidents01234Probability.935.03.02.01.005Find the expected number of accidentseach day. help meeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeee A plant that is 4.1 cm tall is 10.3 cm from a converging lens. You observe that the image of this plant is upright and 6.2 cm tall. What is the focal length of the lens? Prove that the area of the parallelogram is equal to | A B | GRE verbal reasoning scores has an unknowndistribution with a mean of 150.1 and astandard deviation of 9.4. Using the empirical rule,what do we know about thepercentage of GRE verbal reasoning scoresbetween 131.3 and 168.9? a client with multiple myeloma reports severe paresthesia in the feet. when planning care for the client, which priority nursing diagnosis will the nurse choose? 1. What are the similarities and differences between Electronegativity and Ionization Energy? solve for 2 cos x+sqrt2 =0 for opi/43pi/45pi/47pi/4it's 3pi/ 4 and 5pi/4 What are some disadvantages to humans and other organisms of planting one kind of tree? Which of the following methods of timekeeping is the least precise?A. Using a stopwatchB. Using a wrist watchC. Counting your heartbeatsO D. Using a calendar