The fish population of a receding pond is 8,000. The population is expected to decrease at a rate of 8% each year.Which function represents the population of the fish in the pond after x years?

The Fish Population Of A Receding Pond Is 8,000. The Population Is Expected To Decrease At A Rate Of

Answers

Answer 1

Answer: f(x) = 8000(0.92)^x

Explanation:

The formula for calculating exponential decay is expressed as

f(x) = P(1 - r)^x

where

f(x) is the population after a period of x

P is the initial population

r is the decay rate

x is the time

From the information given,

P = 8000

r = 8% = 8/100 = 0.08

By substituting r = 0.08 into the equation. We have

f(x) = 8000(1 - 0.08)^x

f(x) = 8000(0.92)^x


Related Questions

Cassius is purchasing flower baskets to be placed on each table at a volunteer appreciation lunch. Store Acharges $19.25 per flower basket plus a $15.00 delivery fee. Store B charges $17.50 per flower basket plusa $30.00 delivery fee. Which inequality can determine x, the maximum number of flower baskets that canbe ordered for the total cost at Store A to be cheaper the total cost from Store B?O 19.25 + 15x > 17.5 + 30xO 19.25 + 15x < 17.5 + 30x19.25x + 15 < 17.5x + 30O 19.25x + 15 > 17.5x + 30

Answers

We will have the following expressions for store A and B respectively:

[tex]19.25x+15[/tex][tex]17.50x+30[/tex]

From this, we can see that after certain ammount of flowers the price will be better if we arrage it as follows:

[tex]19.25x+15>17.50x+30[/tex]

A boutique sells t-shirts for $30. They pay $12.50 for each shirt and spend $740 for the right to sell the brand in their store. How many t-shirts do they have to sell to break even?

Answers

First let's find the profit for each t-shirt, by subtracting the selling price and the buying price:

[tex]30-12.5=17.5[/tex]

So they have a profit of $17.5 per t-shirt sold.

Now, to find the number of t-shirts they have to sell to break even, we just need to divide the right cost of $740 by the profit value of one t-shirt:

[tex]\frac{740}{17.5}=42.29[/tex]

So they need to sell approximately 43 t-shirts to break even.

Use the point-slope formula to write an equation of the line that passes through 4, 2 and 6,5.Write the answer in slope-intercept form (if possible).

Answers

In this case, we'll have to carry out several steps to find the solution.

Step 01:

data:

point 01 (4 , 2)

point 02 (6 , 5)

Step 02:

equation of the line:

slope:

[tex]m=\frac{y2-y1}{x2-x1}=\frac{5-2}{6-4}=\frac{3}{2}[/tex]

Point-slope form of the line

(y - y1) = m (x - x1)

[tex]\begin{gathered} (y-2)=\frac{3}{2}(x-4) \\ \\ (y-2)=\frac{3}{2}x\text{ -}\frac{12}{2} \\ \\ y-2=\frac{3}{2}x-6 \\ \\ y=\frac{3}{2}x-6+2 \\ \\ y=\frac{3}{2}x-4 \end{gathered}[/tex]

The answer is:

y = 3/2 x - 4

Please give me the correct answer.True or false.If a =b, then a +c = b+c.

Answers

Answer

a = b

a + c = b + c (Addition Property of Equality)

This operation is True.

Explanation

If we are told that

a = b

Adding the same number to both sides of an equation is called the Addition Property of Equality.

And it produces the same number on both sides after this operation.

a = b

Add c to both sides

a = b

a + c = b + c (Addition Property of Equality)

This operation is True.

Hope this Helps!!!

how to find the center and scale factor of #5?

Answers

SOLUTION:

Case: Enlargement

Method:

Scale factor: The scale factor is the 3, because the image is three times the size of the object.

From the tracing, the center of dilation is at C(-2, -2).

Final answer:

Center = (-2, 2)

Scale factor = 3

Bianca bought a baseplate of 12inches length and 10inches width. find the area of the baseplate

Answers

Solution.

Length of the Baseplate = 12inches

Width of the Baseplate = 10inches

[tex]\begin{gathered} \text{Area = Length }\times\text{ Breadth(Width)} \\ \text{ = 12 }\times10 \\ \text{ = 120 in}^2 \\ \end{gathered}[/tex]

Final Answer = 120

Complex numbers are used to describe current. I voltage, E, and impedance, Z. These three quantities are related by the equation E = IZ. Given two ofthese quantities, solve the equation E = IZ for the missing variable.I = 4 + 4i, Z= 7+3iE=(Simplify your answer. Type your answer in the form a+b/. Use integers or fractions for any numbers in the expression.)

Answers

We have the following equation to solve

[tex]E=I\cdot Z[/tex]

Where E, I, and Z are complex numbers, therefore let's put it in numbers

[tex]E=(4+4i)(7+3i)[/tex]

We can solve it directly into the rectangular form by doing the distrutive

Then

[tex](4+4i)(7+3i)=28+12i+28i+12i^2[/tex]

Remember that

[tex]i^2=-1[/tex]

Then

[tex]\begin{gathered} (4+4\imaginaryI)(7+3\imaginaryI)=28+12i+28i-12 \\ \\ (4+4\imaginaryI)(7+3\imaginaryI)=16+40i \end{gathered}[/tex]

Now we have completely solved the problem!

[tex]E=16+40i[/tex]

______________________

The second solution (usual)

When we have real engineering problems, we like to do multiplication and division with the polar form, then let's convert Z and I to the polar form

[tex]\begin{gathered} I=4+4i=4\sqrt{2}\angle45° \\ \\ Z=7+3i=\sqrt{58}\angle23.2° \end{gathered}[/tex]

Now to do the multiplication we multiple the magnitude and sum the phases (angles)

[tex]\begin{gathered} ZI=4\sqrt{2}\cdot\sqrt{58}\angle45°+23.2° \\ \\ ZI=4\sqrt{116}\operatorname{\angle}68.2° \end{gathered}[/tex]

We already have the result, now just put it in the rectangular form

[tex]\begin{gathered} ZI=4\sqrt{116}\cdot\cos(68.2)+i4\sqrt{116}\sin(68.2) \\ \\ E=16+40i \end{gathered}[/tex]

Find each percent decrease. Rounf to thr nearest percent. The first one is done for you.From $60 to $40?

Answers

So the 100% percent is equal to $60 and is decreasing $40 so is:

[tex]60-40=20[/tex]

So is decreasing $20. now we can made a rule of 3 to finde the percentage so:

[tex]\begin{gathered} 60\to100 \\ 20\to x \end{gathered}[/tex]

and the ecuation will be:

[tex]\begin{gathered} x=\frac{100\cdot20}{60} \\ x=33.33\approx33 \end{gathered}[/tex]

So in total the decrese a 33%


1. Describe the shape of
distribution A:
Answer choices:

Symmetric

Negatively skewed

Positively skewed

Uniform

Answers

The shape of the distribution A is Negatively skewed.

What is a negatively skewed distribution?\

A negatively skewed distribution sometimes referred to as a left-skewed distribution, is a type of distribution where more values are concentrated on the right side (tail) of the distribution graph and the left tail of the distribution graph is longer.

The idea of skewness is used in finance to analyze the distribution of investment returns. An investor may anticipate frequent tiny wins and a few significant losses, according to the distribution's negative skewness. In fact, traders frequently use trading methods that are based on distributions that are negatively skewed.

To learn more about negatively skewed distribution, use the link given
https://brainly.com/question/28164315
#SPJ1

f(x) is a linear function. f(0) = 7 and f(3) = 5. Find the equation for f(x).

Answers

Let us calculate the slope of the line. We get two points (0,7) and (3,5)

[tex]m=\frac{7-5}{0-3}=-\frac{2}{3}[/tex]

given the slope we have that

[tex]f(x)=-\frac{2}{3}x+7[/tex]

so the function is:

[tex]f(x)=-\frac{2}{3}x+7[/tex]

Which single transformation below would have the same effect as rotating the point (-3,4) by 180 degrees around the origin and then reflecting it in the y-axis?

Answers

First i will draw the original point in red

the rotation of 180° will give us the point (3,-4) the blue point

next, we reflect this point in the y-axis, the green point

if we see only the red point and the green point the transformation is equivalent to a reflection in the x-axis

the correct answer is 1

It takes Jenny 8.4 minutes to sweep a porch.Mofor can sweep the same porch in 13.3minutes. If they worked together how longwould it take them?

Answers

Rate of Jenny = 1/ 8.4 minutes

Rate of Mofor = 1/13.3 minutes

We know time and rate are inverses of each other.

So, if they work together, their rates would be:

[tex]\frac{1}{8.4}+\frac{1}{13.3}[/tex]

The time they will take will be the inverse of this, thus:

[tex](\frac{1}{8.4}+\frac{1}{13.3})^{-1}[/tex]

So, let's calculate it:

[tex]\begin{gathered} (\frac{1}{8.4}+\frac{1}{13.3})^{-1} \\ =5.1484 \end{gathered}[/tex]

That is around 5.15 minutes.

Question 5 of 9Translate the phrase into a variable expression. Use the letter m to name thevariable. If necessary, use the asterisk (*) for multiplication and the slash(/) for division.... the total number of minutes billed on the phone bill split between 3phones...Answer here

Answers

SOLUTION

From the question, let the total number of minutes billed on the phone bill be m

Splitting this into 3 phones, we have

[tex]\frac{m}{3}[/tex]

Hence the answer is m/3

50 POINTS!!!!!!
1. Angles A and B are supplementary. Determine the measure of angle A if the measure of angle B is 109.6°.

A) 250.4°
B) 63.2°
C) 70.4°
D) 19.6°

Answers

Answer:

C) 70.4°

Step-by-step explanation:

We know supplementary angles add up to 180°:

A + B = 180°

Find the missing one:

A + 109.6° = 180°A = 180° - 109.6°A = 70.4°

Correct choice is C.

C. 70.4
180-109.6=70.4

1 and ∠2 are complementary angles. The measure of ∠1 is 14°. The measure of ∠2 is 4x°. Find the value of x. The figure is not drawn to scale

Answers

1 and ∠2 are complementary angles. The measure of ∠1 is 14°. The measure of ∠2 is 4x°. Find the value of x.

Remember that

the sum of complementary angles is 90 degrees

so

<1+<2=90

substitute given values

14+4x=90

solve for x

4x=90-14

4x=76

x=19

A cosmetics company makes small, cylindrical bars of soap, and wraps them in plastic prior to packing them in boxes for shipping. Each bar of soap has a diameter of 5 cm and is 2 cm in height.a. How much soap material is used to make each bar of soap?b. How much plastic is required to wrap each bar of soap, assuming it is shrink-wrapped tightly around each bar?C.The company wants to be able to ship a minimum of 60 bars per box to save on shipping costs. What will be the dimensions of the box if the soap must be stacked no more than 5 bars high?d. Find the capacity of the box in litres.

Answers

a. In order to determine how much soap material is used for each bar of soap, consider that the shape of the bar is a cylinder, then, use the folowing formula for the volume of a cylinder:

V = π r² h

where r is the radius of the base and h is the height.

The diameter is 5 cm, then, the radius is r = d/2 = 5 cm/2 = 2.5 cm

The height is h = 2 cm

replace the previous values into the formula for V:

V = (3.14)(2.5 cm)²(2 cm)

V = 39.25 cm³

Hence, 39.25 cm³ of soap material is used to make each bar.

b. In this case it is necessary to calculate the suface area of the plastic used. As before, take into account that the bar has a cylindrical shape. Then, use the following formula for the surface area of a cylinder:

S = 2πr² + 2πrh

replace the values of the parameters to find S:

S = 2π(2.5 cm)² + 2π(2.5cm)(2cm)

S = 70.68 cm²

Hence, 70.68 cm² of plastic is required to wrap each bar

c. Take into account that the soap must be stacked no more than 5 bars high, and that the company wants to ship a minimum of 60 bars.

If there are 5 bars high x 3 bars length, in one face of the box you have 15 bars. Moreover, if there are 4 bars width, then, you have a total of 15x4 = 60 bars in one box, which is what the company wants.

The height of the box is given by 5 times the height of one bar (because there are 5 bars high). The length is given by 3 times the diameter of one bar and the width of the box is given by 4 times the diameter of one bar:

height of the box = 5(2 cm) = 10 cm

length of the box = 3(5 cm) = 15 cm

width of the box = 4(5 cm) = 20 cm

d. First, calculate the volume of the box, as follow:

V = h x l x w = (10 cm)(15 cm)(20 cm) = 3,000 cm³

take into account the conversion 1,000 cm³ = 1 L, then, the capacity of the box is:

V = 3,000 cm³ = 3L

If x+4 is a factor of this polynomial, what is the value of a ?

Answers

Answer: -86

Given:

[tex]P(x)=2x^3-11x^2+ax-40[/tex]

If we consider x+4 as a factor of the given polynomial, this would mean that x=-4. For an x- value to be a factor of a polynomial, P(x) must be equal to 0. With that, we will have:

[tex]\begin{gathered} P(-4)=0 \\ P(-4)=2x^3-11x^2+ax-40 \\ 0=2(-4)^3-11(-4)^2+a(-4)-40 \\ 0=-128-176-4a-40 \\ 4a=-128-176-40 \\ 4a=-344 \\ a=-86 \end{gathered}[/tex]

Therefore, the answer is -86

I need help answering the “explain how you found the slope and y intercept question. I did not know how to do this and mainly guessed and got the right answer so I need help explaining please

Answers

When we are given a straight line drawn on the cartesian graph, i.e, having x and y coordinates, the gradient/slope is the change on the y-axis relative to change on the x-axis.

The x-axis is the horizontal axis and the y-axis is the vertical axis.

To get the gradient, we simply pick two points on the line and name them points 1 and 2. Thus, they will have the following attributes:

[tex]\begin{gathered} Point1=(x_1,y_1) \\ Point2=(x_2,y_2) \end{gathered}[/tex]

The gradient of a straight line is:

[tex]s=\frac{y_2-y_1}{x_2-x_1}[/tex]

So, in our question, we can pick our points 1 and 2 at

Point 1 = (-2, 6), (1,-3),

Point 2 = (0, 0), (2,-6)

Applying our formulae, we get:

[tex]\begin{gathered} s=\frac{0-6}{0-(-2)_{}}=-\frac{6}{2}=-3 \\ s=\frac{-6-(-3)}{2-1}=-\frac{3}{1}=-3 \\ \text{Any two points will give us a gradient of -3} \end{gathered}[/tex]

The gradient is -3.

As for the intercept on the y-axis, this is the point on the vertical axis where the graph cuts the graph. It can be visibly seen from our graph as occurring at y = 0.

However, it can be calculated via a formula to give us the form: y = mx + c.

where: m is the gradient/slope and c is the intercept on the y axis.

Formulae for getting conventional line equation is:

[tex]\begin{gathered} \frac{y-y_1}{x-x_1}=\frac{y_2-y_1}{x_2-x_1} \\ \frac{y-6}{x-(-2)}=-3 \\ -3x-6=y-6 \\ \text{Adding 6 to both sides gives:} \\ -3x=y \end{gathered}[/tex]

The line equation is therefore: y = -3x + 0

Slope = -3 AND

y-intercept = 0

2) Hazel McCurry offered $419,400 for a home that had been priced at $439,500. The seller agreed to the offer. If she made a $44,000 down payment, what is the mortgage loan amount?

Answers

ANSWER

$375,400

EXPLANATION

The price of the home was $439,500, but Hazel offered $419,400 so that was the selling price. The down payment was $44,000. Hence, the mortgage loan amount is,

[tex]\text{Mortgage Loan Amount}=419,400-44,000=375,400[/tex]

in a stable there are H horses 6 of them are taken into the the yard to exercise ⁰how many are left in the stable

Answers

Explanation:

If there are H horses and 6 are taken into the yard, then we have 6 horses less in the stable.

Answer:

There are (H - 6) horses left in the stable

Question 3X1127INXRewrite in simplest rational exponent form VxVx. Show each step of your process.

Answers

Given

[tex]\sqrt[]{x}\cdot\sqrt[4]{x}[/tex]

So, we have that

[tex]\begin{gathered} \sqrt[]{x}=x^{\frac{1}{2}} \\ \sqrt[4]{x}=x^{\frac{1}{4}} \end{gathered}[/tex]

Therefore, the expression given is

[tex]x^{\frac{1}{2}}\cdot x^{\frac{1}{4}}[/tex]

Apply the laws of exponents

[tex]x^{\frac{1}{2}+\frac{1}{4}}=x^{\frac{3}{4}}[/tex]

Answer:

[tex]x^{\frac{3}{4}}[/tex]

Y S 18. Graph triangle DEF with vertices D(-5,2), E(1.3), and F(-4,-3). Then graph the image of the triangle after it is translated 4 units right and 3 units down. What are the vertices of triangle D'E'F? 4 3 2 1 o 1 2 J 4 SX YTY

Answers

Graphing the triangle DEF, we have:

Now, translating the triangle 4 units right and 3 units down, we have the new vertices:

[tex]\begin{gathered} D(-5,2)\to D^{\prime}(-5+4,2-3)=D^{\prime}(-1,-1) \\ E(1,3)\to E^{\prime}(1+4,3-3)=E^{\prime}(5,0) \\ F(-4,-3)\to F^{\prime}(-4+4,-3-3)=F^{\prime}(0,-6) \end{gathered}[/tex]

Graphing the triangle D'E'F', we have:

Find S3 of the sum of the geometric series. az = 4, a3 = 1, r= 1

Answers

Given:

a1 = 4

a3 = 1

r = ½

Let's find the S3 of the sum of the geometric series.

Apply the sum of geometric series formula below:

[tex]S_n=\frac{a_1(1-r^n)}{1-r}[/tex]

Let's solve for S3.

Substitute the values into the equation.

Where: n = 3

Thus, we have:

[tex]S_3=\frac{4(1-(\frac{1}{2})^3)^{}^{}}{1-\frac{1}{2}}[/tex]

Solving further:

[tex]\begin{gathered} S_3=\frac{4(1-(\frac{1}{2}\cdot\frac{1}{2}\cdot\frac{1}{2}))}{\frac{1}{2}} \\ \\ S_3=\frac{4(1-\frac{1}{8})}{\frac{1}{2}} \\ \\ S_3=\frac{4(\frac{7}{8})}{\frac{1}{2}} \\ \\ S_3=\frac{4\ast\frac{7}{8}}{\frac{1}{2}} \\ \\ S_3=\frac{\frac{7}{2}}{\frac{1}{2}} \\ \\ S_3=\frac{7}{2}\ast\frac{2}{1} \\ \\ S_3=7 \end{gathered}[/tex]

Therefore, the S3 of the sum of the given geometric series is 7

ANSWER:

7

Which symbol is used to represent Integer Numbers?1. Z2. W3. Q4. N

Answers

Answer: Letter Z.

The notation Z for the set of integers comes from the German word Zahlen, which means "numbers". Integers strictly larger than zero are positive integers and integers strictly less than zero are negative integers.

what is the time it took to reach maximum height? round the answer to the nearest whole second.

Answers

3 seconds

Explanation

we have a graph where

x-axis: indicates the time

y-axis:indicates the height

to solve this we need to find the time, where the maximum heigth is reached

Step 1

check the coordinate where the maximum heigth is reached

and go down vertically to intersect the x-axis:

so, we have , it took around 3 seconds to reach the maximum heigth

I hope this helps you

find f^-1(f(x)) for f(x)=(x-3)/2

Answers

After solving the given equation for f(x) the resultant answer is f(x)=1.

What are equations?A mathematical equation is a formula that uses the equals sign to represent the equality of two expressions. A mathematical statement that has an "equal to" symbol between two expressions with equal values is called an equation. As in 3x + 5 Equals 15, for instance. Equations come in a variety of forms, including linear, quadratic, cubic, and others. The point-slope form, standard form, and slope-intercept form are the three main types of linear equations.

So, find f(x):

When f^-1(f(x)) in f(x)=(x-3)/2.

Now, calculate as follows:

f(x)=(x-3)/2f(x)=(f⁻¹-3)/2f(x)=(1/f - 3)/2f(x)=(1 -3f/f)/2f(x)=(1-3)/2f(x)=2/2f(x) = 1

Therefore, after solving the given equation for f(x) the resultant answer is f(x)=1.

Know more about equations here:

https://brainly.com/question/28937794

#SPJ1

solving compound qualities

Answers

S = {x ∈ R : 3≤x≤12}

1) To solve a compound inequality, we must do it one by one.

Let's start with

1.1) 0≤1/3x -1

1≤1/3x-1+1

1≤1/3x Multiplying both sides by 3

3≤x Flipping it

x≥3

1.2) 1/3x -1≤3

1/3x -1+1≤3+1

1/3x≤4

x≤12

2) Let's find out the solution, by graphing on three lines. The first one for the first solution, the second for the second inequality's solution, and the third for the intersection of the above:

So the Solution set is S = {x ∈ R : 3≤x≤12}

pol: Practice & Problem Solving 2.PS-22 Question Help Three sisters are saving for a special trip. The ratio of Helga's savings to Maurice's savings is 8:3 and the ratio of Maurice's savings to Nora's savings is 3:4. Together all 3 sisters have saved $60. How much has each girl saved? Answer questions 3–4. IS 4 squares long. Then, use the diagrams to show $60. (Type whole numbers.) 4. Complete the table. Helga's savings Maurice's savings Nora's savings $8 $ $24 $32 $ $6 $ $ 12 $4 $ $ $16 + Vi 1 1,0 More Enter your answer in the edit fields and then click Check Answer. 1 pant Clear All Check Answer remaining

Answers

Answer:

Explanation:

We know that the ratio of Helga's savings to Maurice's savings is 8:3 and the ratio of Maurice's savings to Nora's savings is 3:4.

It means that if Helga has $8, Maurice has $3 and Nora has $4

In the same way, we can multiply one quantity by 2, and all the quantities will be multiplied by 2, so if Helga has $16, Maurice has $6 and Nora has $8

Because:

$8 x 2 = $16

$3 x 2 = $6

$4 x 2 = $8

So, following the same logic, we can complete the table as:

Therefore, the complete table is:

Calculate the area of the square JKLM if KM = 42 mm.

Answers

Calculate the area of the square JKLM if KM = 42 mm.

given that KM=42 mm

KM is also the diagonal of the square.

Also, the diagonal KM is the hypotenuse of a right triangle with sides JK and JM the Pythagoras theorem.

Now , let's remember that the angle formed by two sides of a square is equal to 90 degrees, this means, that the angle formed by the diagonal and any side must be the half, it is 45 degrees

so, if we solve the right triangle MLK we will find the length of the s

[tex]\begin{gathered} \text{cos}\emptyset=\frac{x}{\text{Hypotenuse}} \\ x=\text{Hypotenuse }\cdot\text{ cos}\emptyset \\ x=42\cdot\cos 45 \\ x=29.69 \end{gathered}[/tex]

Now, is it a square, so the sides are equal, and the area is given by

[tex]\begin{gathered} \text{Area}=x^2 \\ A\text{rea}=(29.698)^2 \\ \text{Area}=882\text{ square milimeteres} \end{gathered}[/tex]

so, the answer is 882 square millimeters

the figures in each pair are similar. Find the unknown measures.

Answers

[tex]\begin{gathered} m\angle E=78 \\ m\angle M=51 \\ ML=\frac{30}{10}\cdot7=21 \end{gathered}[/tex]

Other Questions
Find the measure of the angle between the two vectors.7) u = (6,-2)v = (8,-8)9) u =(2, 6)v = (-5, -8)8) u = (-2, 3)v = (4, -6)10) u = (-9, 4)v = (-7, -1) Roselle has three cups of popcorn and 6 oz of soda for a total of $246 calories. Carmel has one cup of popcorn and 14 oz of soda for a total of $274 calories. determine the number of calories per cup of popcorn and per ounce of soda A science fair poster is a rectangle 36 inches long and 24 inches wide what is the area of the poster in square feet with sure to include the correct unit in your answer when a weak acid react with a weak base. what's the result the basketball game had 600 people in attendance if the ratio of hawk fans to cyclone fans is 2:10 how many more cyclone fans were there 2. Yan also has three times as many apples as Xavier. Write a second expression for how many apples Yanhas. Find the sum of the interior angles of the shape. Use the remaining angles to solve for x. Polygons Help91120899Sum of interior angles =degreesX =degrees Write a program that asks the user to enter a city name, and then prints Oh! CITY is a cool spot. Your program should repeat these steps until the user inputs Nope.Sample RunPlease enter a city name: (Nope to end) San AntonioOh! San Antonio is a cool spot.Please enter a city name: (Nope to end) Los AngelesOh! Los Angeles is a cool spot.Please enter a city name: (Nope to end) PortlandOh! Portland is a cool spot.Please enter a city name: (Nope to end) MiamiOh! Miami is a cool spot.Please enter a city name: (Nope to end) Nope What is numeral value of 3/4 + 5/8 A cylinder shaped above ground pool is 4.5 deep. If the diameter of the pool is 16 ft, determine the capacity of the swimming pool in cubic feet. Write your awnser in terms of pi 6. 6.5 ounces g7.45 miles km8.2.3 miles cmCovert #6#7#8 How many electrons can be held in a sublevel l = 3? A gas occupies 12.3 L at a pressure of 40 mmHg. What is the volume when the pressure is increases to 60 mmHg? Which of the following notations correctly describe the end behavior of the polynomial graph below? Write an inequality for the word problem and answer the question about the inequality. Eric has an equal number of dimes and quarters that total less than 4 dollars. Could he have 12 dimes The question is in the picture. Using the answer choice word bank, fill in the proportion to find the volume of the larger figure. Why is the population of the Manufacturing Belt shrinking while the population of the Sunbelt is growing? The restriction enzyme EcoR1 recognizes the DNA sequence GAATTC. Which DNA strands will be cut byEcoR1?i. TTCAGGAATTCGGAAACCAAGTCCTTAAGCCTTTGGii. TGAATCGAACCTGACTTAGCTTGGACiii. TTAAGCGGCCGAATTCAGTCCAAATTCGCCCGCTTAAGTCAGGTiv. CAGTAGGATTTCTGTGTCGTCATCCTAAAGACACAG 30 POINTS PLS HELPBecause it is so popular, a store owner increases the cost of a toy by $4.99. The new cost of the toy is $14.84. (a)Write an equation that represents the situation. Use c to represent the original cost of the toy. (b)Solve the equation using a related equation. Show your work.(c)What does the solution of the equation represent? Can someone help me on this Im confused