Stella described protein synthesis as a process that makes the necessary proteins for the human body to function. She explained the process in the following steps

Transcription is mRNA synthesis, which occurs by complementing a segment of the DNA template strand. The translation is the protein growth, which occurs by adding amino acids coded by mRNA codons. C) the polypeptide is 6 amino acids long.  

The whole process of protein synthesis includes Transcription and translation.

TRANSCRIPTION

Transcription is the mRNA synthesis process and occurs in the nucleus.

The DNA template strand is read in direction 3'→ 5' to build the mRNA molecule in direction 5'→ 3'. The template strand is the one that is going to be complemented by the mRNA.

mRNA molecule has the same sequence as the DNA coding strand, but it carries uracil instead of thymine.

TRANSLATION

Translation is the process through which polypeptide grows. It occurs in the cytoplasm.

rRNA and tRNA read mRNA in the direction 5'→ 3' and add the correct amino acids to build the new protein.

Amino acids are coded by mRNA codons. Protein synthesis initiates in the AUG start codon -Metionin- and ends when reaching either of the stop codons UAA, UAG, or UGA.

In the exposed example, we have a DNA strand. We know that it is the coding strand, so it has the same sequence as mRNA molecule.

5' AATCCGTATCTATGACCGTTTGGAAACACTAAGCGGTACTC 3'

5' AAUCCGUAUCUAUGACCGUUUGGAAACACUAAGCGGUACUC 3'

Kowing mRNA sequence, we can grow the protein.

So first, we need to find the initiation codon (AUG), begining from the mRNA 5' extreme. Then we need to find a stop codon (UAA, UAG, or UGA).

5' AAUCCGUAUCUAUGACCGUUUGGAAACACUAAGCGGUACUC 3'

5' AAUCCGUAUCUAUGACCGUUUGGAAACACUAAGCGGUACUC 3'

So this protein begins in AUG and ends in UAA.

To grow the protein, we need to separate mRNA codons and find the corresponding amino acids.

According to this reasoning, the polypeptide is 6 amino acids long. Option C) is correct.

You can learn more about protein synthesis at

https://brainly.com/question/16305501

#SPJ1

Answer: Find your 5

Explanation:

Mesophytes generally require a more or less continuous water supply. They usually have larger, thinner leaves compared to xerophytes, sometimes with a greater number of stomata on the undersides of leaves. Because of their lack of particular xeromorphic adaptations, when they are exposed to extreme conditions they lose water rapidly, and are not tolerant of drought. Mesophytes are intermediate in water use and needs. These plants are found in average conditions of temperature and moisture and grow in soil that has no water logging. The roots of mesophytes are well developed, branched and provided with a root cap. The shoot system is well organised. The stem is generally aerial, branched, straight, thick and hard. Leaves are thin, broad in middle, dark green and of variable shape and measurement.[citation needed]For example, in hot weather they may overheat and suffer from temperature stress. They have no specific adaptations to overcome this, but, if there is enough water in the soil to allow this, they can increase their rate of transpiration by opening their stomata, thus meaning some heat is removed by the evaporating water. However these plants can only tolerate saturated soil for a certain amount of time without a warm temperature. In dry weather they may suffer from water stress (losing more water via transpiration than can be gained from the soil). Again they have no specific adaptations to overcome this, and can only respond by closing their stomata to prevent further transpiration. This does actually have some benefits as it reduces the surface area of the leaves exposed to the atmosphere, which reduces transpiration. Prolonged periods of dehydration, however, can lead to permanent wilting, cell plasmolysis, and subsequent death. Since mesophytes prefer moist, well drained soils, most crops are mesophytes. Some examples are corn (maize), cucurbits, privet, lilac, goldenrod, clover, and oxeye daisy

Between the hand's bones is where the interossei muscles start. There are three palmar interossei and four dorsal interossei. The dorsal interossei allow us to stretch our fingers apart whereas all interossei bend the MCP joints. The interossei on our palms bring our fingers together.

The first and secondhand bones serve as the origin of the greatest dorsal interosseous muscle. When a patient has severe cubital tunnel syndrome because of ulnar nerve injury, it is frequently the first muscle to shrink. It creates the shape between the thumb and index finger when looking at the top of the hand. It draws the thumb towards the index finger as well as dragging the index finger away from the middle finger.

To know more about muscles visit:

https://brainly.com/question/9883108

#SPJ1

Answer: 1 sugar molecule

Explanation:

The basic building block of DNA is called a NUCLEOTIDE. A nucleotide is made up of one sugar molecule, one phosphate molecule and one of the four bases.

No. Carbon dioxide cannot be the only product of the burning of propane. Water is also produced.

Generally, hydrocarbons undergo combustion reactions with oxygen. When this happens, complete combustion leads to the production of carbon dioxide and water.

The general equation for the combustion of hydrocarbons is written as: [tex]C_nH_{2n+2} + (3n+1)/2 O_2 = n CO_2 + (n+1) H_2O[/tex]

Propane is a hydrocarbon with the chemical formula, [tex]C_3H_8[/tex]. Thus, when it burns in oxygen, the equation of the reaction becomes:

[tex]C_3H_8 + 5O_2 -- > 3CO_2 + 4H_2O[/tex]

From this equation, we can see that not only carbon dioxide is produced when propane burns in oxygen, but water molecules as well.

Thus, carbon dioxide cannot be the only product of propane combustion because another product, water, is also formed.

More on propane combustion can be found here: https://brainly.com/question/3014094

#SPJ1

The phytoplankton levels dropped enormously during the El Nino events.

Phytoplankton are the autotrophic organisms of the aquatic habitat. They are the beginners of the aquatic food chains. Phytoplankton belong to the category of algae. The species have the capability of buoyancy and float in the upper regions of the sea where sunlight can reach to them.

El Nino was the phenomenon where the temperature of the sea surface went unusually high. This lead to the occurrence of droughts, floods, and several other calamities. Since the temperature of the sea increased, the conditions turned unfavorable for the blooming of phytoplankton and that is why their population reduced.

To know more about El Nino, here

brainly.com/question/18307318

#SPJ1

The volcanic eruptions has the release of volcanic gas and it provoke climate changes that has a negative effect on the environment.

Answer:

Nautiluses made this development through years of evolution. They developed jet propulsion to help them to better outswim predators.

Explanation:

This is my answer, not a sample answer. Hopefully, it helps! :)

The TCA cycle typically generates 2 molecules of ATP (or GTP) from each molecule of glucose that is totally oxidized to 6 co2 molecules.

Its original definition, "the smallest unit of a substance that yet preserves the qualities of that substance," was intended to be encompassed by this designation. An atom is a body that cannot be divided into two, and a molecule is the tiniest unit of a certain material, according to James Maxwell's definition from 1873.

A molecule is a cluster of two or more atoms that can be divided into smaller recognizable units while still retaining the chemical make-up and physical characteristics of a pure material.

To know more about molecule visit :

https://brainly.com/question/14362857

#SPJ4

Tentacles of an octopus as well limbs of a lizard are analogous structures.

Analogous structures or organs perform the same function in different organisms that bear no resemblance to each other anatomically. Analogous structures are formed as a result of convergent evolution, i.e. different structures evolving for the similar function and thus having similarity. Tentacles of an octopus as well as limbs of a lizard are used for the similar function, i.e. locomotion in this case.

On the other hand, homologous structures result from divergent evolution. Homologous organs contain a similar basic structure but perform distinct functions in different organisms.

To learn more about Homologous organs here

https://brainly.com/question/14963404

#SPJ1

The comparison of the wave shape of an alligator’s low-frequency mating call with the wave shape of a frog’s high-frequency chorus in the way that their shapes are different is that The high-frequency shapes are relatively close together whereas the low-frequency waves are spaced out.

American alligators aren't afraid to make their presence known when they're looking for a mate, and the outcome might sound like a cross between a motorcycle and the loudest snorer ever. An image of a huge male making one of its loud grunting mating sounds is captured on camera.

So, Odorrana tormota and Huia cavitympanum are two species of frogs that are currently recognized for their ability to vocalize at high frequencies, or even partially ultrasonically. Both individuals' hearing systems have been specially modified so they can hear in the high-frequency band.

Therefore, While the high-frequency patterns are closely spaced apart, the low-frequency waves are elongated in both animals.

Learn more about low-frequency from

https://brainly.com/question/21890312

#SPJ1

Answer:

Photosynthesis is when a plant is absorbing water, sunlight, for its energy, This means that your answer is the inputs and outputs have the same type of atoms

Answer:

If you are talking about the 5.03 Photosynthesis Gizmo Quiz, the answer is D. all of the above.

Explanation:

Answer:

The answer is A, stimulus

Answer:

Explanation:

Natural SelectionThe theory of natural selection was the main tenet of Darwin's biological evolutionary scheme, although other important aspects included descent, gradualism, the multiplication of species (including geographic speciation), and sexual selection. While incorporating Malthusian aspects of the multiplication of species and population checks, Darwin's insight was that the stronger members of each species would survive and the weakest would be eliminated (become extinct). These concepts formed the basis of natural selection, which was Darwin's ‘mechanism’ of evolutionary change. Darwin argued for a natural process of variation, struggle, and the selection of traits favorable for survival:Owing to this struggle for life, any variation, however slight and from whatever cause proceeding, if it be in any degree profitable to an individual of any species, in its infinitely complex relations to other organic beings and to external nature, will tend to the preservation of that individual, and will generally be inherited by its offspring. … I have called this principle, by which each slight variation, if useful, is preserved, by the term of Natural Selection, in order to mark its relation to man's power of selection (Darwin, 1859: 61).Darwin's theory of natural selection incorporated the idea that all species were linked to one another in time and space by descent. This was expressed through the metaphor of a branching tree of life, where the trunk symbolized the common ancestor from which all animals had originated. Central to this model of evolutionary development was the idea of a haphazard process of evolution, which rejected progressionist notions of linear development. This haphazard process occurred as each species became better adapted to its surrounding environment. Any environmental changes that occurred would affect the development of the species, and could cause species to diverge onto different branches of evolution, and in some cases to become extinct. The branching tree metaphor was considered early in the development of the theory of natural selection, as shown by a sketch in Darwin's Notebook B (Figure 3) and a detailed diagram was included in The Origin (Figure 4). Here the letters A–L represent parent species which resemble each other to varying degrees (thus spaced unevenly). The dotted lines diverging from each original species represent offspring from these species. Through the process of natural selection over many generations, some original species will develop new varieties and others will become extinct. New species varieties are represented at the top of the diagram (a14, q14, and so on). Darwin meticulously explained this diagram in chapter IV of The Origin, and the strength of his account is reinforced through the written description with which he concluded the chapter:

Darwin's theory of evolution supports the concept of anagenesis (gradualism) of groups (clades) of organisms vs. that of natural selection.

Charles Darwin's theory or Darwinism is a theory of the biological evolution of different species which are developed by the English naturalist Charles Darwin and others, stating that all of the species of organisms arise and develop through the process of natural selection of the small, inherited variations which increase the individual's ability to compete, survive, and reproduce better in the surrounding environmental conditions in which they live in.

The five major theories given by Charles Darwin include evolution of species as such, common descent, gradualism, multiplication of species, and natural selection of species.

Learn more about Darwin's theory of evolution here:

https://brainly.com/question/25718754

#SPJ2

Answer:

The cell membrane, also called the plasma membrane, is found in all cells and separates the interior of the cell from the outside environment. The cell membrane consists of a lipid bilayer that is semipermeable. The cell membrane regulates the transport of materials entering and exiting the cell.

Explanation:

Answer:

Yes, Prokaryotic cells are much smaller than Eukaryotic Cells

Explanation:

Generally, Prokaryotic Cells are smaller as they contain less genetic material and other mechanisms to maintain that material.

Some ways in which octopuses have shown their intelligence in labs has been by completing various maze and opening tricky traps to acquire food rewards.

Octopuses are deep sea creatures who are well known for their 8 suction cups lined limbs along with their bulbous head and ink-secreting mechanism.

Of all the invertebrates octopuses are considered to be the most intelligent creatures.

They have a complex system of neurons that together act as a brain. This allows the octopus to perform various tasks such as touching animals and manipulating its surroundings or smell.

Apart from this all of the octopus's 8 arms can be moved independently from each other.

Some ways in which octopuses have shown their intelligence in labs has been by completing various maze and opening tricky traps to acquire food rewards.

Learn more about octopuses at:

brainly.com/question/26814725

Answer:

f2

Explanation:

Typically, the receptor kinase protein has a transmembrane domain. The non-receptor tyrosine kinase, though, lacks a transmembrane domain.

The main distinction between receptor tyrosine kinases and G protein coupled receptors is that the former can only cause one cell response from a single ligand binding, whereas the latter can cause multiple cell responses from a single ligand binding.

As a transmembrane RTK, HER2 is activated upon dimerization with another receptor from the epidermal growth factor family, such as EGFR (ERBB1), ERBB3 (HER3), and ERBB4 (HER4).

To know more about receptor visit:-https://brainly.com/question/29343237

#SPJ4

• Axial Skeleton,: A division of the skeleton consisting of the skull, thoraz and vertebral column

• Appendicular Skeleton,: A division of the skeleton composed of the girdle and limb bones

• Oviparous,: These organisms lay eggs that develop and hatch outside the mother.

• Viviporous,: These organisms nourish their offspring inside the mother during development and give birth to live young.

• Ovoviviparous,: These organisms carry their young in eggs inside the mother, when the eggs hatch, the mother gives birth to live young.

Problems faced by organisms that live in freshwater are without compensating mechanisms, their bodies tend to take in too much water.

Their bodies have a tendency to absorb too much water since freshwater organisms' environments are hypotonic in nature to their cells, which causes the organisms' bodies to do the same. They are unable to manage their tonicity. Only saltwater causes issues for the creatures who inhabit it.

The osmotic principle states that water travels from a location of low solute concentration (hypotonic) to a region of high solute concentration (hypertonic). As a result, the low solute content in the water creates difficulty for freshwater creatures since they have a tendency to use too much water.

To learn more about Freshwater visit: https://brainly.com/question/3759176

#SPJ4

No. Water cannot be the only product of the combustion of propane because carbon dioxide is also formed simultaneously.

Generally, hydrocarbons undergo combustion reactions with oxygen. When this happens, complete combustion leads to the production of carbon dioxide and water. The general equation for the combustion of hydrocarbons is written as: [tex]C_nH_{2n+2} + (3n+1)/2 O_2 = n CO_2 + (n+1) H_2O[/tex]

Propane is a hydrocarbon with the chemical formula, [tex]C_3H_8[/tex]. Thus, when it burns in oxygen, the equation of the reaction becomes:[tex]C_3H_8 + 5O_2 -- > 3CO_2 + 4H_2O[/tex]

From this equation, we can see that not only water is produced when propane burns in oxygen, but carbon dioxide molecules as well. Thus, water cannot be the only product of propane combustion because another product, carbon dioxide, is also formed.

More on propane combustion can be found here:

https://brainly.com/question/3014094

#SPJ1

As DNA is being translated into RNA during gene expression, the non-coding regions are cut out by a procedure known as RNA splicing.

In the nucleus, transcription occurs. It constructs an RNA molecule from a template made of DNA. Translation takes place when RNA travels from the nucleus to a ribosome in the cytoplasm. A protein is created during translation by reading the genetic code in mRNA.

The information contained in a gene's DNA is transferred to RNA (ribonucleic acid), a molecule comparable to DNA, in the cell nucleus during transcription. Both RNA and DNA are composed of a series of units known as nucleotides.

To know more about rna visit:-

https://brainly.com/question/20914096

#SPJ4

Answer:

The correct answer option is True.

Explanation:

Volume can be measured in liters or cubic meters - it is true.

The measure of the amount of space which an object or a substance can occupy is said to be its volume.

The basic unit of volume in the metric system is a liter while the SI unit of the volume is the cubic meter.

Therefore, the given statement is true.

Answer: It converts corbon to dox

Explanation:

Answer: Epithelial Tissues

A lion, a crocodile, and a wild dog.

The experimental result that displayed the central pattern generators' involvement in muscle contractions is that 'an insect in which the sensory afferents from the wings have been cut can fly', which suggests that option C is the right answer.

Central pattern generators are neuronal circuits which when activated produce rhythmic motor patterns such as walking, breathing or flying etc. in the absence of sensory signals. Muscle contraction refers to the activities such as tightening, shortening, or lengthening of muscles when some activity is performed by the body. It is caused due to the information signal received by the brain and then returned back to site of stimuli. The experiments conducted displayed that a deafferented locust could generate rhythmic flight motor patterns in response to non-rhythmic stimulation of the nerve cord.  

Learn more about Central pattern generators at:

brainly.com/question/15565886

#SPJ4

To refer to complete question, see below:

Which experimental results would demonstrate that central pattern generators are involved in producing the muscle contractions involved in rhythmic movement?

a. A cat whose cerebral cortex has been removed can walk and run on a treadmill.

b. A cat whose cerebral cortex has been removed has impaired balance on a treadmill.

c. An insect in which the sensory afferents from the wings have been cut can fly.

d. An insect in which the sensory afferents from the wings have been cut has an unusually slow wingbeat frequency.

The best description of warm current from the choices given above is that: They are surface currents.

The correct answer choice is option d.

Warm current can simply be defined as that current which usually moves towards the poles from the equator. It is a fallacy to believe that warm current move from the poles to the Equator as described among the choices given above.

However, they are surface currents and the water inside them is usually, frequently and most of the time more warmer than the surrounding water.

In conclusion, it can be deduced from the explanation given above that warm current influence the climatic zones.

Read more on warm current:

https://brainly.com/question/16018929

#SPJ1