Please help me I don’t know if I’m right or missing any other to select.

Please Help Me I Dont Know If Im Right Or Missing Any Other To Select.

Answers

Answer 1

The given equations are

[tex]-x+4y=7[/tex][tex]6x-3y=42[/tex]

To find the answer we need to cancel out x or y.

so we have to find the LCM of the coefficients of the corresponding variable.

consider the coefficients of x is -1 in the first equation and 6 in the second equation .

Lcm of -1 and 6 is 6.

Multiplying the first equation by 6.

consider the coefficients of y is 4 in the first equation and -3 in the second equation .

Lcm of 4 and 3 is 12

Multiplying the first equation by 3 and the second equation by 4.

Either one of these is the first step to eliminate variables.

Amswer os


Related Questions

Tonya leaves home on her motorcycle and travels 12 miles east and 7 miles north. How far in Tonya from her original starting point?

Answers

The distance is 13.892 miles.

Given:

Distance travelled in east is 12 miles.

Distance travelled in north is 7 miles.

The objective is to find how far is tonya from the starting point.

The distance between starting point and ending point can be calculated using Pythagorean theorem.

Consider the given figure as,

By applying Pythagorean theorem,

[tex]AC^2=AB^2+BC^2[/tex]

Now, substitute the given values in the above formula.

[tex]\begin{gathered} x^2=12^2+7^2 \\ x^2=144+49 \\ x^2=193 \\ x=\sqrt[]{193} \\ x=13.892 \end{gathered}[/tex]

how do I know what exponent and base I use when I simplify an exponent, for example, 16^1/4 become (2^4)^1/4 which becomes 2. How do I know I have to use 2^4 instead of another number like 4^2 that is still equal to 16. Why can't I use a different number that is equal to the same thing?

Answers

Answer:

Reason:

16^1/4=(2^4)^1/4

Explanation:

You can use either 4^2 or 2^4 both gives the same answer.

In order to simplify the steps we use 2^4.

we get,

[tex]16^{\frac{1}{4}^{}^{}}=(2^4)^{\frac{1}{4}}[/tex][tex]=2^{4\times\frac{1}{4}}[/tex]

4 in the power got cancelled and we get,

[tex]=2[/tex]

Alternate method:

If we use 4^2 we get,

[tex]16^{\frac{1}{4}}=(4^2)^{\frac{1}{4}}[/tex][tex]=4^{2\times\frac{1}{4}}[/tex][tex]=4^{\frac{1}{2}}[/tex]

we use 4=2^2,

[tex]=(2^2)^{\frac{1}{2}}=2[/tex]

In order to get answer quicker we appropiately use 2^4=16 here.

Rules in exponent:

[tex]a^n\times a^m=a^{n+m}[/tex][tex]\frac{a^n}{a^m}=a^{n-m}[/tex][tex]\frac{1}{a^m}=a^{-m}[/tex][tex](a^n)^m=a^{n\times m}[/tex][tex]4^{3\times\frac{1}{2}}=4^{\frac{3}{2}}[/tex]

use 4=2^2, we get

[tex]=2^{2\times\frac{3}{2}}[/tex]

2 got cancelled in the power, we get

[tex]=2^3[/tex][tex]=8[/tex]

we get,

[tex]4^{3\times\frac{1}{2}}=8[/tex]

As a fraction in simplest terms, what would you multiply the first number by to get the second? First number: 56 Second number: 57

Answers

We're asked to find a number x such that by being multiplied by 36 becomes 57, so we need

[tex]\begin{gathered} 56x=57 \\ x=\frac{57}{56} \end{gathered}[/tex]

then

[tex]56(\frac{57}{56})=57[/tex]

Evaluate the expression. 2 13 21 The value of the expression is

Answers

To solve the exercise you can use the following property of powers

[tex](\frac{a}{b})^n=\frac{a^n}{b^n}[/tex]

Then, you have

[tex]\begin{gathered} |(\frac{-1}{2})^3\div(\frac{1}{4})^2|=|\frac{(-1)^3}{(2)^3}^{}\div\frac{(1)^2}{(4)^2}^{}| \\ |(\frac{-1}{2})^3\div(\frac{1}{4})^2|=|\frac{-1^{}}{8}^{}\div\frac{1}{16}^{}| \end{gathered}[/tex]

Now, apply the definition of fractional division, that is

[tex]\frac{a}{b}\div\frac{c}{d}=\frac{a\cdot d}{b\cdot c}[/tex][tex]\begin{gathered} |(\frac{-1}{2})^3\div(\frac{1}{4})^2|=|\frac{-1^{}\cdot16}{8\cdot1}^{}| \\ |(\frac{-1}{2})^3\div(\frac{1}{4})^2|=|\frac{-1^{}6}{8}^{}| \\ |(\frac{-1}{2})^3\div(\frac{1}{4})^2|=|-2| \end{gathered}[/tex]

Finally, apply the definition of absolute value, that is, it is the distance between a number and zero. The distance between -2 and 0 is 2.

Therefore, the value of the expression is 2.

[tex]\begin{gathered} |(\frac{-1}{2})^3\div(\frac{1}{4})^2|=|-2| \\ |(\frac{-1}{2})^3\div(\frac{1}{4})^2|=2 \end{gathered}[/tex]

15. A beekeeper estimates that his bee population will triple each year.

Answers

Answer:

[tex]P\mleft(x\mright)=150(3^x)[/tex]

Explanation:

The initial number of bees = 150

[tex]P(0)=150[/tex]

The beekeeper estimates that his bee population will triple each year. Thus, after 1 and 2 years:

[tex]\begin{gathered} P(1)=150\times3 \\ P(2)=150\times3\times3=150\times3^2 \end{gathered}[/tex]

Continuing in like manner, after x years:

[tex]P(x)=150(3^x)[/tex]

P(x) is the required function.

How does the value of 1 in Maisha’s time compare with the value of 1 in Patti’s time?

Answers

the equilibrium is above the factors of 1/2 so if you divide the two exponets by the power of pi

Please help me find the inverse of f(x) = 2^x. I think that will help me label these?

Answers

Given function:

[tex]f(x)=2^x[/tex]

To obtain the inverse of the function f(x), we follow the steps outlined below:

Step 1: Replace f(x) with y:

[tex]y=2^x[/tex]

Step 2: Interchange x and y

[tex]x=2^y[/tex]

Step 3: Solve for y:

[tex]\begin{gathered} \text{Take logarithm of both sides} \\ \log x=log2^y \\ y\log 2\text{ = log x} \\ \text{Divide both sides by log2} \\ y\text{ = }\frac{\log x}{\log \text{ 2}} \\ y\text{ = }\log _2x \end{gathered}[/tex]

Step 4: Replace y with f-1(x):

[tex]f^{-1}(x)\text{ = }\log _2x[/tex]

Answer:

[tex]f^{-1}(x)\text{ = }\log _2x[/tex]

PDonald has xxx twenty-dollar bills and 111 ten-dollar bill

Answers

the equation for this problem is

20x +10

where x is the number of bills with 20-dollars

You are choosing 4 of your 7 trophies and arranging them in a row on a shelfIn how many different ways can you choose and arrange the trophies?A. 840B. 28C. 24D. 5040

Answers

The formula to find how many different ways are there to choose a subgroup of r things from a group of n things is

[tex]\frac{n!}{(n-r)!}[/tex]

Here, you have 7 trophies and you want to choose 4 of them, so you have

[tex]\frac{7!}{(7-4)!}\text{ = }\frac{5040}{6}=840[/tex]

So there are 840 ways to choose your 4 trophies out of the 7 you have.

Write 3.6x10^-4 in standard form

Answers

In order to write the given number in standard form, you take into account that the factor 10^(-4) can be written as follow:

[tex]10^{-4}=\frac{1}{10^4}[/tex]

Next, you consider that the number of the exponent in a 10 factor means the number of zeros right side number 1:

[tex]\frac{1}{10^4}=\frac{1}{10000}[/tex]

that is, there are four zeros right side of number 1.

Finally, you write the complete number:

[tex]3.6\times10^{-4}=\frac{3.6}{10^4}=\frac{3.6}{10000}[/tex]

What is 44.445 to the nearest hundredth

Answers

Answer:

44.45

Explanation:

Given 44.445

We are to convert to the nearest hundredth

Since the last value at the back is greater than 4, we will add 1 to the preceding value behind it to make it 5 as shown

44.445 = 44.4(4+1) [1 is added to the second value from the back

44.445 = 44.45

Hence the value to nearest hundredth is 44.45

Which products are greater than 2 5/6?A.1/8 × 2 5/6B.2 5/6 × 2 5/6C.2 5/6 × 1 5/8D.5/6 × 2 5/6E.6/5 × 2 5/6

Answers

First, we need to change the mixed number to an improper fraction:

[tex]2\frac{5}{6}=\frac{(6\cdot2)+5}{6}=\frac{17}{6}\approx2.83[/tex]

Now let's evaluate each of the options:

A.

[tex]\frac{1}{8}\times2\frac{5}{6}=\frac{1}{8}\times\frac{17}{6}=\frac{1\cdot17}{8\cdot6}=\frac{17}{48}\approx0.354[/tex]

B.

[tex]2\frac{5}{6}\times2\frac{5}{6}=\frac{17}{6}\times\frac{17}{6}=\frac{17\cdot17}{6\cdot6}=\frac{289}{36}\approx8.02[/tex]

C.

[tex]2\frac{5}{6}\times1\frac{5}{8}=\frac{17}{6}\times\frac{13}{8}=\frac{17\cdot13}{6\cdot8}=\frac{221}{48}\approx4.60[/tex]

D.

[tex]\frac{5}{6}\times2\frac{5}{6}=\frac{5}{6}\times\frac{17}{6}=\frac{5\cdot17}{6\cdot6}=\frac{85}{36}\approx2.36[/tex]

E.

[tex]\frac{6}{5}\times2\frac{5}{6}=\frac{6}{5}\times\frac{17}{6}=\frac{6\cdot17}{5\cdot6}=\frac{17}{5}\approx3.4[/tex]

Now, we can conclude that options B, C, and E are greater than 2 5/6.

what is the fill in for the diagram drop downs drop down 1: is it a reflexive property, equivalent equation or transitive property of equality.drop down 2: does it have subtraction property of equality, divison of equality or reflexive property and lastly drop down 3: is it a substitution, equivalent equation or subtraction property of equality

Answers

Explanation:

Remember the following properties of real numbers:

Reflexive property:

This property states that a number is always equal to itself.

This property is different from the equivalent equations property. In fact, two equations that have the same solution are called equivalent equations,

Division property of equality:

This property states that when we divide both sides of an equation by the same non-zero number, the two sides remain equal.

Substitution property of equality:

This property states that if x = y, then x can be substituted in for y in any equation.

We can conclude that the correct answer is:

Answer:

Drop Down 1: reflexive property

Drop Down 2: division property of equality.

Drop Down 3: substitution

what are the consecutive perfect cubes which added to obtain a sum of 100?441?​

Answers

Answer:add 341 more cubes and that shall be your answer

1,2, 3 and 4 are the consecutive perfect cubes which added to obtain a sum of 100.

What is Number system?

A number system is defined as a system of writing to express numbers.

Consecutive perfect cubes which added to obtain a sum of 100

Perfect cubes are the numbers that are the triple product of the same number.

1³+2³+3³+4³

One cube plus two ube plus three cube plus four cube

1+8+27+64

One plus eight plus twenty seven plus sixty four.

100

1,2, 3 and 4 are the consecutive perfect cubes which added to obtain a sum of 100.

Hence, 1,2, 3 and 4 are the consecutive perfect cubes which added to obtain a sum of 100.

To learn more on Number system click:

https://brainly.com/question/22046046

#SPJ2

Find the distance between (-4, 2) and (10, 2) c. -14d. 14

Answers

The distance between two points (a, b) and (c, d) is given by:

[tex]\sqrt[]{(c-a)^2+(d-b)^2}[/tex]

For points (-4, 2) and (10, 2), we have:

a = -4

b = 2

c = 10

d = 2

Thus, the distance between those points is

[tex]\sqrt[]{\lbrack10-(-4)\rbrack^2+(2-2)^2}=\sqrt[]{(10+4)^2+0}=\sqrt[]{14^2}=14[/tex]

Therefore, the answer is 14.

I tried but immediately got confused on what to start with

Answers

Radius of the inscribed circle.

Given:

Side length of square = 8cm

From the diagram, the circumference of the inscribed circle touches the sides of the square. Hence, we can say that the diameter of the inscribed circle is equal to the side length of the square.

The diagram below shows this relationship

We know that the radius (r) is related to the diameter (d) as

=O REAL NUMBERSDistributive property: Integer coefficientsUse the distributive property to remove the parentheses.+(-5u-+*+4)INOPX 5 ?

Answers

The given expression is:

[tex]-(-5u-x+4)[/tex]

Using the distributive property of multiplication over addition, we have

[tex]\begin{gathered} -(-5u-x+4)=-(-5u)-(-x)-(+4) \\ =+5u+x-4=5u+x-4 \end{gathered}[/tex]

Therefore, removing the paranthesis gives:

5u + x - 4

.

Carolyn has a circular swimming pool with a diameter of 20 feet. She needs to know the area of the bottom of the pool so that she can find out how much paint to buy for it. What is the approximate area?

Answers

To find the area of the bottom we have to use the formula to find the area of a circle:

[tex]A=\pi r^2[/tex]

Where A is the area and r is the radius.

The first step is to find the radius of the circle, which is half the diameter:

[tex]\begin{gathered} r=\frac{D}{2} \\ r=\frac{20ft}{2} \\ r=10ft \end{gathered}[/tex]

Replace r in the given formula and use 3.14 as pi:

[tex]\begin{gathered} A=3.14\cdot(10ft)^2 \\ A=314ft^2 \end{gathered}[/tex]

The answer is 314ft^2.

Suppose that the manufacturer of a gas clothes dryer has found that, when the unit price is p dollars, the revenue R (in dollars) is R(P) = -9p2 + 18,000p. What unitprice should be established for the dryer to maximize revenue? What is the maximum revenue?

Answers

Suppose that the manufacturer of a gas clothes dryer has found that, when the unit price is p dollars, the revenue R (in dollars) is R(P) = -9p2 + 18,000p. What unit

price should be established for the dryer to maximize revenue? What is the maximum revenue?

we have the quadratic equation

[tex]R(p)=-9p^2+18,000p[/tex]

this is a vertical parabola, open downward

the vertex represents a maximum

Convert to factored form

Complete the square

factor -9

[tex]R(p)=-9(p^2-2,000p)[/tex][tex]R(p)=-9(p^2-2,000p+1,000^2-1,000^2^{})[/tex][tex]\begin{gathered} R(p)=-9(p^2-2,000p+1,000^2)+9,000,000 \\ R(p)=-9(p^{}-1,000)^2+9,000,000 \end{gathered}[/tex]

the vertex is the point (1,000, 9,000,000)

therefore

the price is $1,000 and the maximum revenue is $9,000,000

Problem N 2

we have the equation

[tex]C(x)=0.7x^2+26x-292+\frac{2800}{x}[/tex]

using a graphing tool

the minimum is the point (8.58,308.95)

therefore

Part a

the average cost is minimized when approximately 9 lawnmowers ........

Part b

the minimum average cost is approximately $309 per mower

Given that the points (-2, 10), (5, 10), (5, 1), and (-2, 1) are vertices of a rectangle, how much longer is the length than the width? A) 1 unit B) 2 units 0) 3 units D) 4 units E) 5 units

Answers

The length of both sides is obtained by subtracting one coordinate from another sharing a similar coordinate.

(-2,10) - (5,10) = (-7,0)

These points are 7 units apart.

Let's compare the other length.

(5,10) - (5,1) = ( 0, -9)

These points are 9 units apart.

Therefore, the length is longer than the breadth by 9 - 7 = 2 units

Option B

I need help with statistical problem I have got the answer of 0.3354 because I subtracted 0.9991 - 0.146 I wanted to know if that was correct I kept getting the answer wron

Answers

From the quetion

We are given a normal distribution with mean = 0 and standard deviation = 1

The sketch of the distribution is as shown below

Therefore option C is the correct answer

We are to find the probability that a given score is between -2.18 and 3.74

The probability is

[tex]P\mleft(-2.18Therefore,

The probability is 0.9853

Mr. Eric’s business class has 91 students, classified by academic year and gender, As illustrated in the following table. Mr. Eric randomly chooses one student to collect yesterday’s work. What is the probability that he selects a female, given that he chooses randomly from only the juniors? Express your answer as a fraction.

Answers

Given:

Eric’s business class has 91 students

Mr. Eric randomly chooses one student to collect yesterday’s work

We will find the probability that he selects a female, given that he chooses randomly from only the juniors

As shown from the table:

The number of females from the juniors = 6

The number of juniors = 6 +13 = 19

So, the probability will be =

[tex]\frac{6}{19}[/tex]

Set B and Set C are grouped according to the Venn Diagram below. Set B is (9, 12, 14, 17, 18) and Set C is (6,9,11, 12, 18, 19). The sample space is (1, 6, 9, 11, 12, 14, 17, 18, 19, 20).

Answers

To get the probability of an event to occur, we have the following formula:

[tex]P=\frac{no.\text{ of favorable outcomes}}{\text{total no. of possible outcomes}}[/tex]

According to the problem, the sample space is (1, 6, 9, 11, 12, 14, 17, 18, 19, 20) therefore, the total no. of possible outcomes is 10.

For Set B, the sample is (9, 12, 14, 17, 18), therefore, there are 5 possible outcomes that belong to set B.

Starting with the first question, what is the probability of Set B to occur?

[tex]P=\frac{no.\text{ of outcomes from B}}{\text{total no. of possible outcomes}}=\frac{5}{10}=\frac{1}{2}=0.50=50\text{ percent}[/tex]

For Set C, the sample is (6,9,11, 12, 18, 19) therefore, there are 5 possible outcomes that belong to set C as well.

On the next question, what is the probability of Set C to occur?

[tex]P=\frac{no.\text{ of outcomes from C}}{\text{total no. of possible outcomes}}=\frac{5}{10}=\frac{1}{2}=0.50=50\text{ percent}[/tex]

For the third question, what is the probability of Set B or C to occur?

Since the outcomes under B or C are (6, 9, 11, 12, 14, 17, 18, 19), the probability of the union of B and C is:

[tex]P=\frac{no.\text{ of outcomes from B or C}}{\text{total no. of possible outcomes}}=\frac{8}{10}=\frac{4}{5}=0.80=80\text{ percent}[/tex]

On to the last question, what is the probability of the intersection of B and C to occur?

Since the outcomes that are found on both B and C are (9,12,18), the probability of the intersection of B and C is:

[tex]P=\frac{no.\text{ of outcomes found on both B and C}}{\text{total no. of possible outcomes}}=\frac{3}{10}=0.30=30\text{ percent}[/tex]

Write an equation for the area and solve the equation for x.

Answers

Given the figure of a rectangle

The area = A = 26

Length = x + 6

width = x + 2

Area = length * Width

so, the equation of the area will be:

[tex]A=(x+6)(x+2)[/tex]

so,

[tex](x+6)(x+2)=26[/tex]

solve for x as follows:

[tex]\begin{gathered} x^2+8x+12=26 \\ x^2+8x+12-26=0 \\ x^2+8x-14=0 \\ \end{gathered}[/tex]

Use the general rule to find the value of x

So,

[tex]\begin{gathered} a=1,b=8,c=-14 \\ x=\frac{-b\pm\sqrt[]{b^2-4ac}}{2a}=\frac{-8\pm\sqrt[]{64-4\cdot1\cdot-14}}{2\cdot1} \\ \\ x=\frac{-8\pm\sqrt[]{120}}{2}=\frac{-8\pm2\sqrt[]{30}}{2}=-4\pm\sqrt[]{30} \end{gathered}[/tex]

So, the answer will be:

[tex]\begin{gathered} A=(x+6)(x+2)_{} \\ \\ x=-4+\sqrt[]{30},-4-\sqrt[]{30} \end{gathered}[/tex]

THE GRAPH OF THIS SYSTEM OF LINEAR INEQUALITIES IS X-2Y< OR EQUAL 6 X> OR EQUAL TO 0 Y< OR EQUAL TO 2GRAPH

Answers

The graph of the system of linear inequalities x - 2y ≤ 6 , x ≥ 0 and y ≤ 2 is attached below.

The system of linear inequalities is x - 2y ≤ 6 , x ≥ 0 and y ≤ 2

The solution set of  x ≥ 0 includes {x ∈ R , x ≥ 0 }

The solution set of  y ≤ 2 includes {y ∈ R , y ≤ 2 }

The solution set of x - 2y ≤ 6 , shows the region of the graph that is below the straight line x - 2y = 6 .

Let us now plot the graph of the straight line x - 2y = 6 with the slope of -1/2 .

At x = 0 ,  y = - 3

At x = 2 , y = - 2

At x = -4 , y = - 5

hence the graph will pass through the points (0,-3) , (2,-2) and (-4,-5)

The line x = 0 indicates the x-axis and the line y=2 indicates the straight line parallel to x axis passing through (0,2) .

The shaded region of the graph indicates the solution set of the system of inequalities.

To learn more about inequality  visit:

brainly.com/question/20383699

#SPJ9

What is the y intercept of this table?Х 0,3,6. y 5,11,17

Answers

We are given a table of x-values and their corresponding y values for a function. We are asked to express the y-intercept.

Since the table reads that for x= 0 the associated value id y = 5, then right from that info we can say that the function intercepts the y axis at the point y=5.

In coordinate pair point it reads like: (0, 5)

Recall that the y-intercept is the point at which the function crosses the y-axis, and that happens when x = 0.

Consider the line y=7x-7Find the equation of the line that is perpendicular to this line and passes through the point (-8,5) Find the equation of the line that is parallel to this line and passes through the point (-8,5)

Answers

Given:

The equation of a straight line is,

[tex]y=7x-7[/tex]

The objective is to find,

a) The equation of perpendicular line passes throught the point (-8,5).

b) The equation of parallel line passes throught the point (-8,5).

Explanation:

The general equation of straight line is,

[tex]y=mx+c[/tex]

Here, m represents the slope of the straight line and c represents the y intercept.

a)

For perpendicular lines, the prouct of slope of two lines will be (-1).

By comparing the general equation and the given equation the slope value will be,

[tex]m_1=7[/tex]

Now, the slope value of perpendicular line can be calculated as,

[tex]\begin{gathered} m_1\times m_2=-1 \\ 7\times m_2=-1 \\ m_2=-\frac{1}{7} \end{gathered}[/tex]

Since, the perpendicular line passes through the point (-8,5), the equation of line can be calculated using point slope formula.

[tex]\begin{gathered} y-y_1=m_2(x-x_1)_{} \\ y-5=-\frac{1}{7}(x-(-8)) \\ y-5=-\frac{1}{7}(x+8) \\ y-5=-\frac{x}{7}-\frac{8}{7} \\ y=-\frac{x}{7}-\frac{8}{7}+5 \\ y=-\frac{x}{7}-\frac{8}{7}+\frac{35}{7} \\ y=-\frac{x}{7}+\frac{27}{7} \end{gathered}[/tex]

Hence, the equation of perpendicular line is obtained.

b)

For paralle lines the slope value will be equal for both lines.

[tex]m_1=m_3=7[/tex]

Since, the parallal line passes through the point (-8,5), the equation of line can be calculated using point slope formula.

[tex]\begin{gathered} y-y_1=m_3(x-x_1) \\ y-5=7(x-(-8)) \\ y-5=7(x+8) \\ y-5=7x+56 \\ y=7x+56+5 \\ y=7x+61 \end{gathered}[/tex]

Hence, the equation of parallel line is obtained.

Find the indicated values for the function f(x)= Answer all that is shown

Answers

For this problem, we are given a certain function and we need to evaluate it in various points.

The function is given below:

[tex]f(x)=\sqrt{5x-15}[/tex]

The first value we need to calculate is f(4), we need to replace x with 4 and evaluate the expression.

[tex]f(4)=\sqrt{5\cdot4-15}=\sqrt{20-15}=\sqrt{5}=2.24[/tex]

The second value we need to calculate is f(3), we need to replace x with 3 and evaluate the expression.

[tex]f(3)=\sqrt{5\cdot3-15}=\sqrt{15-15}=0[/tex]

The third value we need to calculate is f(2), we need to replace x with 2 and evaluate the expression.

[tex]f(2)=\sqrt{5\cdot2-15}=\sqrt{10-15}=\sqrt{-5}[/tex]

The value for this is not real.

Given that line AB is tangent to the circle, find m

Answers

Solution:

Given the figure below:

To solve for m∠CAB, we use the chord-tangent theorem which states that when a chord and a tangent intersect at a point, it makes angles that are half the intercepted arc.

Thus,

[tex]m\angle CAB=\frac{1}{2}\times arc\text{ CDB}[/tex]

where

[tex]\begin{gathered} m\angle CAB=(4x+37)\degree \\ arc\text{ CDB=\lparen9x+53\rparen}\degree \end{gathered}[/tex]

By substituting these values into the above equation, we have

[tex]4x+37=\frac{1}{2}(9x+53)[/tex]

Multiplying through by 2, we have

[tex]\begin{gathered} 2(4x+37)=(9x+53) \\ open\text{ parentheses,} \\ 8x+74=9x+53 \end{gathered}[/tex]

Collect like terms,

[tex]\begin{gathered} 8x-9x=53-74 \\ \Rightarrow-x=-21 \\ divide\text{ both sides by -1} \\ -\frac{x}{-1}=-\frac{21}{-1} \\ \Rightarrow x=21 \end{gathered}[/tex]

Recall that

[tex]\begin{gathered} m\operatorname{\angle}CAB=(4x+37)\operatorname{\degree} \\ where \\ x=21 \\ thus, \\ m\operatorname{\angle}CAB=4(21)+37 \\ =84+37 \\ \Rightarrow m\operatorname{\angle}CAB=121\degree \end{gathered}[/tex]

Hence, the measure of the angle CAB is

[tex]121\degree[/tex]

which of the following is an even fonction?
g(x)=(x-1)² +1
9(x) = 2x² +1
9(x) = 4x+2
g(x) = 2x

Answers

Answer:

g(x)=2x^2 +1 would be the even function

Step-by-step explanation:

To find if a function is even, you substitute -x for every x in the function. If the function stays the exact same, the function is even. For the first one, (x-1)^2 +1, If -x is substituted, we get (-x-1)^2 +1, which is not the same as the original function.

2x^2 +1 = 2(-x)^2 +1 =2x^2 +1  This function is even

(a negative squared will be positive)

4x+2 = 4(-x)+2 =-4x +2  This function is not even

2x = 2(-x) = -2x This function is not even

Other Questions
Two pointsA(0,-4),B(2,-1)determine lineAB.What is the equation of the line AB?y= _1_x + _2_What is the equation of the line perpendicular to lineAB, passing through the point(2,-1)?y= _3_x + _4 Find the measure of the angle between the two vectors.7) u = (6,-2)v = (8,-8)9) u =(2, 6)v = (-5, -8)8) u = (-2, 3)v = (4, -6)10) u = (-9, 4)v = (-7, -1) Roselle has three cups of popcorn and 6 oz of soda for a total of $246 calories. Carmel has one cup of popcorn and 14 oz of soda for a total of $274 calories. determine the number of calories per cup of popcorn and per ounce of soda A science fair poster is a rectangle 36 inches long and 24 inches wide what is the area of the poster in square feet with sure to include the correct unit in your answer when a weak acid react with a weak base. what's the result the basketball game had 600 people in attendance if the ratio of hawk fans to cyclone fans is 2:10 how many more cyclone fans were there 2. Yan also has three times as many apples as Xavier. Write a second expression for how many apples Yanhas. Find the sum of the interior angles of the shape. Use the remaining angles to solve for x. Polygons Help91120899Sum of interior angles =degreesX =degrees Write a program that asks the user to enter a city name, and then prints Oh! CITY is a cool spot. Your program should repeat these steps until the user inputs Nope.Sample RunPlease enter a city name: (Nope to end) San AntonioOh! San Antonio is a cool spot.Please enter a city name: (Nope to end) Los AngelesOh! Los Angeles is a cool spot.Please enter a city name: (Nope to end) PortlandOh! Portland is a cool spot.Please enter a city name: (Nope to end) MiamiOh! Miami is a cool spot.Please enter a city name: (Nope to end) Nope What is numeral value of 3/4 + 5/8 A cylinder shaped above ground pool is 4.5 deep. If the diameter of the pool is 16 ft, determine the capacity of the swimming pool in cubic feet. Write your awnser in terms of pi 6. 6.5 ounces g7.45 miles km8.2.3 miles cmCovert #6#7#8 How many electrons can be held in a sublevel l = 3? A gas occupies 12.3 L at a pressure of 40 mmHg. What is the volume when the pressure is increases to 60 mmHg? Which of the following notations correctly describe the end behavior of the polynomial graph below? Write an inequality for the word problem and answer the question about the inequality. Eric has an equal number of dimes and quarters that total less than 4 dollars. Could he have 12 dimes The question is in the picture. Using the answer choice word bank, fill in the proportion to find the volume of the larger figure. Why is the population of the Manufacturing Belt shrinking while the population of the Sunbelt is growing? The restriction enzyme EcoR1 recognizes the DNA sequence GAATTC. Which DNA strands will be cut byEcoR1?i. TTCAGGAATTCGGAAACCAAGTCCTTAAGCCTTTGGii. TGAATCGAACCTGACTTAGCTTGGACiii. TTAAGCGGCCGAATTCAGTCCAAATTCGCCCGCTTAAGTCAGGTiv. CAGTAGGATTTCTGTGTCGTCATCCTAAAGACACAG 30 POINTS PLS HELPBecause it is so popular, a store owner increases the cost of a toy by $4.99. The new cost of the toy is $14.84. (a)Write an equation that represents the situation. Use c to represent the original cost of the toy. (b)Solve the equation using a related equation. Show your work.(c)What does the solution of the equation represent?