PLEASE HELP ITS RLLY IMPORTANT.

Consider the model of Ammonia to the right. Which terms would be used to describe this model? Element, molecule, and/or compound? Explain your reasoning.

PLEASE HELP ITS RLLY IMPORTANT. Consider The Model Of Ammonia To The Right. Which Terms Would Be Used

Answers

Answer 1
Ammonia is a chemical compound because it composed of one nitrogen atom and three hydrogen atoms,

Related Questions

Which of the following statements best describes a
mixture?
O A substance that contains two or more elements chemically joined
O A substance that contains two or more elements not chemically joined
O A substance that contains only one type of atom
O A substance that contains two or more compounds or elements that are
not chemically joined.​

Answers

The last one. A mixture isn’t chemically combined.

find the number of molecules in 35.20 g of nitrogen dioxide

Answers

Answer:

4.584*10^23 molecules

Explanation:

Find molar mass of nitrogen and oxygen on periodic table.

find molar mass of nitrogen dioxide

use this to find moles of nitrogen dioxide

multiply by avagadros number

find molar mass by dividing grams by molar mass of nitrogen dioxide, then multiple by avogadro’s number to find number of molecules. 4.61 x 10^23 molecules. 3 sf

What does Ra Ra Ah Ah Ah Ro Ma Ro Ma Ma Ga Ga O La La mean?

Answers

Answer:

They are symbols of elements.

Ra is the symbol of the element Radium

Ah is the symbol of the element Arrhenium

Ma  is the symbol of the element Molybdenum

Ga  is the symbol of the element Gallium

La  is the symbol of the element Lanthanum

Answer:

Ra is the symbol of the element Radium

Ah is the symbol of the element Arrhenium

Ma  is the symbol of the element Molybdenum

Ga  is the symbol of the element Gallium

La  is the symbol of the element Lanthanum

Explanation:

They are elements

Scientists have been classifying living organisms for centuries. In the 1970s, organisms were classified in a five-kingdom
classification scheme. However, two decades later, organisms called Archaebacteria were discovered. This led to a three-domain
system of classification that combined some of the previous five-kingdom schemes.
What does this change in classification methods demonstrate?

Answers

Answer:

Classification is important because it allows scientists to identify, group, and properly name organisms via a standardized system (Linnaeus Taxonomy); based on similarities found in the organisms DNA/RNA (genetics), Adaptations (Evolution), and Embryonic development (Embryology) to other known organisms to better.

Hope I helped!!

The five kingdoms of classifications were animalia, plant, fungi, protista and monera. Later Archaebacteria was discovered and this led to the 3 kingdom classification animalia, plantae and protista.

What is biological classification?

There are different classifications for living things based on their nature, body and origin. The kingdom animalia includes  all the animals including human beings.

Kingdom plante includes all the plants and kingdom fungi, protista and monera are of microbes. Later the discovery and study of Archaebacteria proved that they exhibit similar body type and functions as bacterias.

After that, scientists turned into 3 kingdom classification, where all the prokaryotic organisms including protists, monera and fungi classified as one. The evolutional changes originated in them made this classification.

To find more on biological classification, refer here:

https://brainly.com/question/2994982

#SPJ2

Kevin is working on a model that shows the positions of Earth, the Moon, and the Sun during the phases of
the Moon. How should he position them to show a New Moon?

Answers

Answer:

Explanation:what’s the answer

Answer: A. With Earth between the Moon and the Sun.

Explanation:

How many moles of ethanol are produced starting with 500.g glucose?

C6H12O6 → 2 C2H5OH + 2 CO2

Answers

Answer:

5.55 mol C₂H₅OH

General Formulas and Concepts:

Math

Pre-Algebra

Order of Operations: BPEMDAS

Brackets Parenthesis Exponents Multiplication Division Addition Subtraction Left to Right

Chemistry

Atomic Structure

Reading a Periodic TablesMoles

Stoichiometry

Using Dimensional AnalysisAnalyzing Reactions RxNExplanation:

Step 1: Define

[RxN - Balanced] C₆H₁₂O₆ → 2C₂H₅OH + 2CO₂

[Given] 500. g C₆H₁₂O₆ (Glucose)

[Solve] moles C₂H₅OH (Ethanol)

Step 2: Identify Conversions

[RxN] 1 mol C₆H₁₂O₆ → 2 mol C₂H₅OH

[PT] Molar mass of C - 12.01 g/mol

[PT] Molar Mass of H - 1.01 g/mol

[PT] Molar Mass of O - 16.00 g/mol

Molar Mass of C₆H₁₂O₆ - 6(12.01) + 12(1.01) + 6(16.00) = 180.18 g/mol

Step 3: Stoichiometry

[DA] Set up conversion:                                                                                 [tex]\displaystyle 500 \ g \ C_6H_{12}O_6(\frac{1 \ mol \ C_6H_{12}O_6}{180.18 \ g \ C_6H_{12}O_6})(\frac{2 \ mol \ C_2H_5OH}{1 \ mol \ C_6H_{12}O_6})[/tex][DA} Multiply/Divide [Cancel out units]:                                                         [tex]\displaystyle 5.55001 \ mol \ C_2H_5OH[/tex]

Step 4: Check

Follow sig fig rules and round. We are given 3 sig figs.

5.55001 mol C₂H₅OH ≈ 5.55 mol C₂H₅OH

During a hurricane, what effect can the ocean have on the beach?

Answers

As the hurricane moves toward shore, the underwater tumult can cause shifting sands and muddy shallow waters, blocking the essential sunlight on which corals and other sea creatures rely. (Brainliest please)

______ occur between molecules that have permanent intramolecular differences in elecronegativity.
A. Dipole-dipole interactions
B. Dispersion forces
C. Hydrogen bonds​

Answers

The answer is dipole dipole interactions

Answer:

Dipole-dipole interactions

Explanation:

Thermal energy that encounters greenhouse gases cannot escape the atmosphere? Yes or no

Answers

Answer:

Yes

Explanation:

The point of greenhouse gases is that it absorbs and emits radiant energy within the thermal infrared range and causes it to be trapped.

Question 2 (1 point)
(02.01 LC)
Which scientist proposed the model of an atom as a solid sphere? (1 point)

John Dalton

Niels Bohr

Ernest Rutherford

William Crookes

Answers

Answer:

John Dalton

Explanation:

Both John Dalton and Democritus thought that the atom was an indivisible sphere until J.J. Thompson came out with the plum pudding model. Hope I helped!

What rock forms from magma oozing onto the surface?
a. Igneous rock
b. Metamorphic rock
C. Sedimentary rock
d. Lava rock

Answers

Answer: A. Igneous rock
Igneous Rock is formed when magma, has a high temperature. Cooling off makes the lava harden. Creating igneous rock

Zinc metal reacts with copper sulfate through the following
reaction:
Zn + CuSO4 → Cu + ZnSO4
The percent yield for a reaction in which 32.5 g of Zn is reacted
in excess CuSO4 solution is 85.0 %. What is the actual yield of
copper of this reaction?
g

Answers

Answer:26.9

Explanation:

Find a part of the article that describes signals that are sent within Diego’s body. Where does the signal come from, and how does it cause Diego to feel or react?

Answers

Answer:

The sensory receptors send signals to Diego's brain cells. These signals are messages that help Diego figure out what to do next. As Diego thinks, more signals move from one brain cell to another.

The sensory receptors send signals to Diego's brain cells. These signals are messages that help Diego figure out what to do next. As Diego thinks, more signals move from one brain cell to another.

What are sensory receptor?

The capacity to react to stimuli is one of the traits of a living thing. The highly developed sensory system of humans can concurrently analyze thousands of incoming messages.

Dendrites of sensory neurons are specialized for receiving particular types of stimuli and are known as sensory receptors. There are three ways to classify sensory receptors.

Exteroceptors are located at or close to the skin's surface and are responsive to stimuli coming from the outside or the body's surface. These receptors include those for vision, hearing, smell, and taste as well as those for touch, pain, and temperature.

Therefore, The sensory receptors send signals to Diego's brain cells. These signals are messages that help Diego figure out what to do next. As Diego thinks, more signals move from one brain cell to another.

To learn more about sensory receptors, refer to the link:

https://brainly.com/question/3190796

#SPJ2

describe which process in the water cycle the water in each picture will go through next will go through next.

Answers

Answer:

water vapour I guess I the answer of your question

The equivalence point in a titration refers to the point when

A. the mł of the acid equals the mL of the base.

B. the molarity of the acid used in the reaction equals the molarity of the base used in the reaction.

C. the number of moles of one reactant reacts completely with the moles of the other reactant.

D. the acid in the flask turns clear.

Answers

Answer:

C) the number of moles of one reactant reacts completely with the moles of the other reactant.

Explanation:

it's right put it

Answer:

C

Explanation:

What is the percent composition of a 16.75 g sample of a compound containing 14.02 g oxygen and 2.73 g hydrogen? Select the correct answer below: 83.7% oxygen, 16.3% hydrogen O 17% oxygen, 13% hydrogen O 68.2% oxygen, 31.8% hydrogen 89.5% oxygen, 10.5% hydrogen ​

Answers

Answer:

83.7% oxygen, 16.3% hydrogen

Explanation:

Mass of compound = 16.75 g

Mass of Oxygen = 14.02 g

Mass of Hydrogen =  2.73 g

Percentage composition = Mass of element /  Mass of compound    100%

Percentage composition of Oxygen = 14.02 g / 16.75 g    * 100%

Percentage composition of Oxygen = 0.837 * 100 = 83.7%

Percentage composition of Hydrogen = 2.73 g / 16.75 g    * 100%

Percentage composition of Hydrogen = 0.163 * 100 = 16.3%

The correct option is;

83.7% oxygen, 16.3% hydrogen

Answer:

83.7% oxygen, 16.3% hydrogen

Explanation:

To determine the percent composition we can divide, our mass by total mass and afterwards, multiply by 100.

(Mass of O / Total mass) . 100 = % O

(Mass of H / Total mass) . 100 = % H

Remember that:

% O + % H = 100

Mass of O / Total mass + Mass of H / Total mass = 1

(14.02 g / 16.75g) . 100 = 83.7 %

(2.73 g /16.75g) . 100 = 16.3 %

Rock is driven underground and changed by heat and pressure. This describes
what?
a. Igneous changing to sedimentary
b. Metamorphic changing to sedimentary
C. Sedimentary changing to metamorphic
d. Sedimentary changing to igneous

Answers

Answer:

Explanation:

metamorphic

B is the answer I think

Fossil fuels are made up of organisms that died millions of years ago. Which best describes this source of energy

Answers

nonrenewable
hope this helps

Balance equation mg3n2+h2so4=mgso4+(nh4)2​

Answers

Answer:

Mg₃N₂  +  4 H₂SO₄  ⇒  3 MgSO₄  +   (NH₄)₂SO₄

Explanation:

To balance an equation, you need to make both sides of the equation have equal number of each element.  Also, I think that you didn't write the whole equation since the reaction you gave is not likely.

Mg₃N₂  +  4 H₂SO₄  ⇒  3 MgSO₄  +   (NH₄)₂SO₄

Suppose an EPA chemist tests a 250.mL sample of groundwater known to be contaminated with nickel(II) chloride, which would react with silver nitrate solution like this: NiCl2(aq) + 2AgNO3(aq) → 2AgCl(s) + NiNO32(aq) The chemist adds 15.0mM silver nitrate solution to the sample until silver chloride stops forming. He then washes, dries, and weighs the precipitate. He finds he has collected 5.8mg of silver chloride. Calculate the concentration of nickel(II) chloride contaminant in the original groundwater sample. Round your answer to 2 significant digits.

Answers

Answer:

0.0010 w/v %

Explanation:

Based on the reaction:

NiCl₂(aq) + 2AgNO₃(aq) → 2AgCl(s) + Ni(NO₃)₂(aq)

Finding the moles of AgCl produced we can find the moles of NiCl in the reaction medium and its mass:

Moles AgCl -Molar mass: 143.32g/mol-:

5.8mg = 5.8x10⁻³g * (1mol / 143.32g) = 4.047x10⁻⁵ moles AgCl

Moles NiCl₂:

4.047x10⁻⁵ moles AgCl * (1mol NiCl₂ / 2mol AgCl) = 2.023x10⁻⁵ moles NiCl₂

Mass NiCl₂ -Molar mass: 129.60g/mol-:

2.023x10⁻⁵ moles NiCl₂ * (129.60g / mol) = 2.62x10⁻³g of NiCl₂ are produced.

And the concentration in w/v% is:

2.62x10⁻³g NiCl₂ / 250mL * 100 =

0.0010 w/v %

What is the atomic mass of element XX if 3.6 moles of the substance has a mass of 192 grams?

Answers

Answer:

53.3g/mol

Explanation

Moles=mass/molar mass

Molar mass= mass/moles

Molar mass= 192/3.6

= 53.3

which is the best explanation for why organisms must meet their needs for resources?
a. So they can have more entertainment.
b. So they can survive and reproduce.
c. So they can continue sleeping all day.
d. So they can swim and fly faster.

Answers

Answer:

B

Explanation:

A isnt correct because animals have no emotions

C isnt correct because animals dont sleep all day

D isnt correct because not all organisms can swim or fly

B makes the most sense

What is the purpose of the scientific method?

A. To use an experiment to test a scientific theory

B. To make a guess in order to prove a hypothesis

C. To remove any source of bias in an experiment

D. To provide a reliable answer to a specific question

Answers

Answer:

B. To make a guess in order to prove a hypothesis.

Explanation:

D. To provide a reliable answer to a specific question

why do you think season will impact the size of a rabbit population​

Answers

They would get out of there burrows in around spring when they are mostly out and the start reproducing

The type of potential energy related to an object's height

Answers

Answer:

the answer is gravitational potential energy

Answer:

Since the gravitational potential energy of an object is directly proportional to its height above the zero position, a doubling of the height will result in a doubling of the gravitational potential energy. A tripling of the height will result in a tripling of the gravitational potential energy.

Explanation:

Hope this helps?

Increased concentrations of greenhouse gases will lead to HIGHER global temperatures.

True
or
False

Answers

Answer:

[tex]\huge\boxed{\sf True}[/tex]

Explanation:

If the concentrations of greenhouse gases keep increasing, They will absorb more and more long wave energy coming from the sun and radiating from the earth's surface and thus will cause an increase in temperature.

[tex]\rule[225]{225}{2}[/tex]

Hope this helped!

~AH1807

90% of people marry there 7th grade love. since u have read this, u will be told good news tonight. if u don't pass this on nine comments your worst week starts now this isn't fake. apparently if u copy and paste this on ten comments in the next ten minutes you will have the best day of your life tomorrow. you will either get kissed or asked out in the next 53 minutes someone will say i love you

HELPPP HURRY FIRST GET BRAINLEST The rusting of steel wool occurs when the iron in the steel wool combines with what substance?

carbon dioxide
hydrogen
nitrogen
oxygen

Answers

Answer:

iron oxide. aka. oxygen

Explanation:

Rust is the result of a chemical reaction between iron and oxygen, otherwise known as iron oxide. Since steel wool -- and steel in general -- is largely made of iron, steel wool is prone to rust if it doesn't have a rustproof coating on it. The actual reaction that creates rust happens when two iron atoms mix with three oxygen atoms in water; the oxygen bonds to the metal, and a new compound is formed.

4. What is the specific heat of a substance if 5800 joules is
released in a 250 gram sample that will cool the substance from
60 degrees to 45 degrees?

Answers

Answer: 23.2

Explanation:

Liquids B and C are partially miscible at 25 oC. When one starts with 1 mol of C at 25 oC and isothermally adds B a little at a time, a two-phase system first appears when a bit more than 0.125 mol of B has been added; continuing to add B, one finds the two-phase system becomes a one-phase system when a total of 3 mol of B has been added. For a system consisting of 2.5 mol of B and 2 mol of C at 25 oC, find the number of moles of B and of C present in each phase.

Answers

Answer:

[tex]0.8\overline 3[/tex] moles of A and 2.5 moles of B in the one-phase system

[tex]1.1 \overline 6[/tex] moles of A and [tex]0.1458 \overline 3[/tex] moles of B in the two-phase system

[tex]0.3541 \overline 6[/tex] moles of B remains in the system

Explanation:

The given parameters are;

The extent of miscibility of liquid B and C = Partially miscible

The number of moles of liquid B added to 1 mole of liquid A that forms a two-phase system = 0.125 mol of liquid B

The number of moles of liquid B added to 1 mole of liquid A that forms a one -phase system = 3 moles of liquid B

Whereby the system consist of 2.5 mol of B and 2 mol of C at 25°C, we have;

The 1 mole of A mixes with 3 moles of B to form a single phase solution

Therefore;

2.5 moles of B will mix with (1/3)×2.5 moles of A = 5/6 moles of A

The remaining number of moles of A in the system = 2 - 5/6 =  7/6 moles of A

Similarly, we have;

At least, 0.125 mole of B combines with 1 mole of A to form a two-phase system

7/6 moles of A will combine with 7/6 × 0.125 = 7/48 moles of B to form a two-phase system

The number of moles of B left = 0.5 - 7/48 = 17/48 = 0.3541[tex]\overline 6[/tex] moles of A

Therefore, we have;

5/6 moles of A and 2.5 moles of B in the one-phase system

7/6 moles of A and 7/48 moles of B in the two-phase system

17/48 moles of B remaining in the system

PLEASE HELP ME PLEASE!!

Answers

Answer:

1: f 2: b 3: d 4: e 5:a 6:c

Explanation:

Other Questions
Find the exact value of x.Thank you Find the volume of the triangular prism in the picture shown. Round your answer to thenearest tenth. *1: 1672:77.3 yd3: 77 yd What three dimensional shape is made when you rotate a triangle horizontally? Read and choose the correct verb in the preterite tense to complete the sentence.Nosotras ________ un buen viaje. tuve tuvo tuvimos tuviste In Act 3, Scene 1, Tybalt confronts Romeo and challenges him to a duel. What is the dramatic irony of this scene that motivates Romeo to forgive the insult by Tybalt? transcribe this strand of DNA 5' 3 TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid- Answer this PLZZZZZZ The Roman god Neptune and the Greek god Poseidon BOTH were considered to be the god ofA)war.B)time.C)the sea.D)the underworld A smoothie shop has 40 stores and 55% of the stores are in California. The rest of the stores are in Nevada. How many stores are in California? 22184595 Identify and explain three factors that contributed to the origin of the Cold War The ____________________ is the reproductive structure of gymnosperms. find the size of angle X. hi please help with my maths! a partir del texto,resuelvan las siguientes preguntas:A)En que ao se lanzaron las sondas voyager 1 y voyager 2 I NEED AN ANSWER ASAP. A brief summary of the career and contributions of James Galway and his flutist career what are the two elements found in silicon dioxide URGENT !!!!!!!!! Please answer correctly !!!!! Will be marking Brianliest !!!!!!!!!!!!!!!! URGENT !!!!!!!!! Please answer correctly !!!!! Will be marking Brianliest !!!!!!!!!!!!!!! y= 4/3x -8 4x-3y=24 A larger car takes more force to move._O Newton's 1st lawO Newton's 2nd lawO newton's 3rd lawO newton's 4th law