Jack paid $46 for 4 pizzas. How much did he pay per pizza?

Answers

Answer 1

Answer:

$11.50

Step-by-step explanation:

46/4=11.5

In money have to make it the hundredths, so it's $11.50.

Here's a similar question.

https://brainly.com/question/25209884?referrer=searchResults

Answer 2

Answer:

$11.50

Step-by-step explanation:

$46 ÷ 4 = 11.5


Related Questions

Solve. Round the answer to the nearest cent, if necessary.Last year the profit for a company was $483,000. This year's profit decreased by 2.1%. Find this year's profit.

Answers

year's

this year´s profit is $ 472857

Explanation

we can easily solve this by using a rule of three

so

Step 1

a)let x represents this year's profit

so

if it is decreases by 2.1 %

[tex]\begin{gathered} x=100-2.1\text{ = 97}.9 \\ x=97.9\text{\%} \end{gathered}[/tex]

so, this year's profit is 97.9% of the last year profit

hence

[tex]\begin{gathered} \text{if} \\ 483000\rightarrow100\text{ \%} \\ x\rightarrow97.9\text{ \%} \end{gathered}[/tex]

we can make a proportion

[tex]\frac{483000}{100}=\frac{x}{79}[/tex]

finally, solve for x,

[tex]\begin{gathered} \frac{483000}{100}=\frac{x}{97.9} \\ \text{Multiply both sides by 9}7.9 \\ \frac{483000}{100}\cdot97.9=\frac{x}{97.7}\cdot97.9 \\ 472857=x \end{gathered}[/tex]

therefore

this year´s profit is $ 472857

I hope this helps you

hi, I'm supposed to write a exponential equation for the graph but I'm not sure how to do it

Answers

d)

To determine the type of function, we would compare the y values. If the ratio of consecutive y values is the same, then the function is exponential. We have

2/1 = 4/2 = 8/4 = 2

Thus, it is an exponential function. The general formula for an exponential function is

y = ab^x

We would find a and b

Substituting x = 0 and y = 1 into the formula, we have

1 = ab^0

1 = a

Substituting x = 1 and y = 2 into the formula, we have

2 = ab^1

2 = ab

Substituting a = 1 into 2 = ab, then

2 = 1 * b = b

By substituting a = 1 and b = 2 into the original formula, the equation would be

y = 2^x

Julias frogs are 2/5 of the amount of Remus frogs. If Remus gives a half of his frogs to Julia, what will the ratio of Julia's frogs to Remus frogs be ?

Answers

Let:

Rf = Remus frogs

Jf = Julias frogs

[tex]Jf=\frac{2}{5}Rf[/tex]

If Remus gives a half of his frogs to Julia, what will the ratio of Julia's frogs to Remus frogs be ? so:

[tex]\begin{gathered} Rf=\frac{5}{2}Jf \\ Jf=\frac{2}{5}Rf+\frac{1}{2}Rf=\frac{9}{10}Rf \end{gathered}[/tex]

Therefore, the ratio will be:

[tex]\frac{\frac{9}{10}Rf}{Rf-\frac{1}{2}Rf}=\frac{9}{5}[/tex]

what is the sum of the expression 2/12 + 2/4

Answers

EXPLANATION:

In the exercise we have to perform the sum of two improper fractions which are heterogeneous because they have different denominators.

The procedure is the next:

[tex]\begin{gathered} \frac{2}{12}\text{ }+\frac{2}{4};=\frac{8+24}{48}=\frac{32}{48};\text{here }we\text{ simplify} \\ \\ \frac{32}{48}=\frac{16}{24}=\frac{8}{12}=\frac{4}{6}=\textcolor{#FF7968}{\frac{2}{3}} \\ \text{the answer is }\frac{2}{3} \end{gathered}[/tex]

solve for x……………………..

Answers

Answer:

7.5/3

Step-by-step explanation:

7x-7.5 = 4x

-7.5 = -3x

x= 7.5/3

Could you help me with these two questions? 20 points !

1 ) Create an equation in point-slope form that has a slop of 5 passing through the points (3,5)

2) Create an equation in point slop form that has a slop of 2 and passes through the points (-1, 6)

Answers

The equation of line are given as y = 5x - 10 and y = 2x + 8 respectively

Point-Slope Formula

The point slope form is used to find the equation of the straight line which is inclined at a given angle to the x-axis and passes through a given point. The equation of a line is an equation that is satisfied by each and every point on the line. This means that a linear equation in two variables represents a line. The equation of a line can be found through various methods depending on the available information.

In this case, we have can proceed to write the equation of a straight line which is given as y = mx + c

m = slopec = y-intercept

Let's find the y - intercept and write the equation.

y = mx + c

5 = 5(3) + c; c = 5 - 15 = -10

y = 5x - 10

2) We have the slope as 2 and the points are (-1, 6)

The equation of the line can be written in form of y = mx + c

6 = 2(-1) + c

6 = -2 + c; c = 8

The equation is given as y = 2x + 8

Learn more on point-slope form here;

https://brainly.com/question/6497976

#SPJ1

the radius of a semicircle is 5 kilometers. what is the semicircles diameter

Answers

The semicircles diameter is 10km

What is diameter?

The diameter is defined as twice the length of the radius of a circle.

From the relation diameter of a circle is given as d= 2r

Radius of the semicircle is 5km

Substitute the radius in to d=2r

diameter= 2 x 5= 10km

Therefore, the semicircles diameter is 10km

Learn more about diameter here: https://brainly.com/question/390660

#SPJ1

can you guys s show work for graph inequality for

-2<x<5​

Answers

The graph of the inequality is a straight line on the x-axis

from -2 to 5 also, -2 & 5 are not included in the graph.

Given, an inequality

-2 < x < 5

we have to draw a graph for the given inequality,

as the value of 'x' is from -2 to 5.

So, the graph of the inequality is a straight line on the x-axis

from -2 to 5 also, -2 & 5 are not included in the graph.

Hence, the graph of the inequality is a straight line on the x-axis

from -2 to 5 also, -2 & 5 are not included in the graph.

Learn more about Linear Inequalities here https://brainly.com/question/25944814

#SPJ9

find the unit rate. round to the nearest hundredth, if necessary $200 for 15 ft

Answers

EXPLANATION

The unit rate is given by the following relationship:

Unit rate= $200/15ft = $13.3333.../ft

Then, rounding to the nearest hundreth:

Unit rate = $13.33/ft

Find the length of RS.A.73 unitsB.11 unitsC.About 8.5 unitsD About 3.3 units

Answers

Let,

[tex]\begin{gathered} R=(x_1,y_1)=(-4,1) \\ S=(x_2,y_2)=(-1,9) \end{gathered}[/tex]

The expression to calculate the distance between two points is,

[tex]\begin{gathered} D=\sqrt[]{(x_2-x_1)^2+(y_2-y_1)^2} \\ D=\sqrt[]{(-1-(-4))^2+(9-1)^2} \\ D=\sqrt[]{(3)^2+(8)^2} \\ D=\sqrt[]{9+64} \\ D=\sqrt[]{73} \\ D=8.5\text{ units} \end{gathered}[/tex]

Thus, the length of the line RS is 8.5 units, and the correct option is option C.

12__-15 = -3
divide
multiply
add
subtract

Answers

Answer:

multiply 1 is the correct answer

12×1 - 15 = -3

You have learned about quadratic and linear function in earlier grades. Explain in a variety of ways how you can distinguish the exponential function
f(x)=2^x
from the quadratic function
f(x) = x^2
and linear function
f(x) = 2x
. (Hint: compare the rate of change using finite differences in tables of values, and identify a constant ratio in the table of values).

Answers

We can distinguish between the linear, exponential function and quadratic functions graphically. The graph of the functions is as follows:

linear function f(x) = 2x will be straight line,

for exponential function f(x) = 2^x will rise or fall quickly in one direction

and for quadratic function f(x) = x^2 will be a parabola.

What is an exponential function?An exponential function is a type of mathematical function expressed in the form f(x) = a^x. where "x" is a variable and "a" is a constant  called the base of the function, which must be greater than 0. The most commonly used exponential  base is the transcendental number e, which is approximately equal to 2.71828. The exponential function is defined by the formula f(x) = ax. where the input variable x is displayed as an exponent. Exponential curves grow or fall exponentially. A quantity that increases or decreases at a  regular rate should exhibit either an exponential increase or an exponential decay.

To learn more about exponential function from the given link :

https://brainly.com/question/14355665

#SPJ1

Solve this equation for N. 3N + 5 = 38

Answers

ANSWER

N = 11

EXPLANATION

Given:

3N + 5 = 38

Desired Outcome:

Value of N

Solve for N

[tex]\begin{gathered} 3N+5=38 \\ subtract\text{ 5 from both sides} \\ 3N+5-5=38-5 \\ 3N=33 \\ divide\text{ both sides by 3} \\ \frac{3N}{3}=\frac{33}{3} \\ N=11 \end{gathered}[/tex]

Hence, the value of N is 11.

How does the allusion to the Pied Piper in “Pan: God of the Wild” contribute to the meaning of the myth?


i need help

Answers

The allusion to the pied piper in "Pan: God of the wild" contributes to the meaning of the myth by B. showing that Pan is a god that leads others to  destruction.

What's the story of the pied piper about?

The story goes that the pied piper went into a town infested with rats and made a deal with the people of the town to drive the rats away for a token. The town agreed and the pied piper drove the rats into the river. When the piped piper asked for his money, they refused to pay up. The pied piper took his revenge on the town by leading children of the town away from the town and they were never discovered.

The myth only shows that Pan is a god that leads others to destruction.

Learn more about Pied piper here:

https://brainly.com/question/20345653

#SPJ1

the side length of 11

Answers

A perfect square means that the given value is the result of the multiplication of an integer with itself, for example 2*2=4 →√

(8u^2+3u-4)+(8u^2+3u-1)-(3u^2-3u-8)

Answers

Simplify the expression

[tex]\mleft(8u^2+3u-4\mright)+\mleft(8u^2+3u-1\mright)-\mleft(3u^2-3u-8\mright)​[/tex]

Removing all the parentheses, taking special care to change the signs of the last three terms:

[tex]8u^2+3u-4+8u^2+3u-1-3u^2+3u+8​[/tex]

Now collect like terms:

[tex]8u^2+8u^2-3u^2+3u+3u+3u-4-1+8​[/tex][tex]13u^2+9u+3​[/tex]

Write the equation of the line parallel to x+7y=21 that passes through the point (–14, 4).

Answers

Answer:

Equation of line is given as y = mx + c, where m is the gradient and c is the y-intercept.

First, rearrange x + 7y = 21 into y = mx + c form.

x + 7y = 21

7y = - x + 21

y = -1/7x + 3

Parallel lines have the same gradient so gradient of line is -1/7.

Equation of line is now y = -1/7x + c.

Substitute (-14,4) into the equation to find c.

4 = -1/7(-14) + c

4 = 2 + c

c = 2

Hence, equation of line is y = -1/7x + 2.

A bakery is selling breakfast platters. A platter of 12 bagels costs $10.80. Additionally, it costs $6.50 for a gallon of coffee.

What is the slope of this situation?

0.11
0.90
6.50
10.80

Answers

The slope of the given situation of selling breakfast platters is 0.90.

Given, the platter of 12 bagels costs $10.80.

The extra cost of $6.50 for a gallon of coffee.

To find the slope of the situation, we convert the situation into the equation of the line.

y=mx+c

here c is the extra cost that is 6.50.

12m=10.80

For 12 bagels , the cost is 10.80, then the slope will be the cost of each bagel.

m=10.80/12

m=0.90

m=$0.90

Therefore, option c 0.90 is the slope of the given situation of the bakery selling the breakfast platter of 12 bagels and a gallon of coffee.

To know more about slope here:

https://brainly.com/question/2491620#

#SPJ1

Given f(x) = 5x − 7 and g(x) = −4x + 2, what is (f − g)(x)? x − 9 x − 5 9x − 9 9x − 5

Answers

To get (f-g)(x), we're essentially just factoring out x from f(x) and g(x).

-> f(x) - g(x) = x(f-g), and by the properties , x(f-g) is the same as (f-g)(x).

Therefore, (f-g)(x) = 5x - 7 - (-4x + 2) = 5x - 7 + 4x - 2 = 9x - 9.

Answer:

[tex](f-g)(x)=9x - 9[/tex]

Step-by-step explanation:

Given functions:

[tex]\begin{cases}f(x) = 5x-7 \\ g(x) = -4x + 2\end{cases}[/tex]

To find (f - g)(x), subtract function g(x) from function f(x):

[tex]\begin{aligned}(f-g)(x)&=f(x)-g(x)\\&=(5x-7)-(-4x+2)\\&=5x-7+4x-2\\&=5x+4x-7-2\\&=9x-9\end{aligned}[/tex]

Therefore, the solution to the given composite function is:

[tex]9x-9[/tex]

HELP PLEASE HELP PLEASE NEED IT NOW!!
You run m miles on Monday, the same amount on Tuesday, and 3 miles on Wednesday. Write an expression in the simplest form that represents the total amount in each situation.
(please show work)

Answers

The expression that represents the given situation is 2x + 3 = T.

What do we mean by expression?An expression, often known as a mathematical expression, is a finite collection of symbols that are well-formed in accordance with context-dependent principles.You must substitute a number for each variable and carry out the arithmetic operations in order to evaluate an algebraic expression. Since 6 + 6 equals 12, the variable x in the example above is equal to 6. If we are aware of the values of our variables, we can substitute those values for the original variables before evaluating the expression.

So, the expression to represent the given situation is:

Since the miles run on Monday and Tuesday are the same, then let the miles run be 'x'.

Miles run on Monday is x.Miles run on Tuesday is x.Miles' run on Wednesday is 3.

Let, the total mile be T.

Now, the expression will be:

x + x + 3 = T2x + 3 = T


Therefore, the expression that represents the given situation is 2x + 3 = T.

Know more about expressions here:

https://brainly.com/question/28934492

#SPJ1

Given MK is a median use the figure below to answer the questions below.



If JM = 23, then JL =

If LJ = 20, then ML =

Answers

Answer:

[tex]46, 10[/tex]

Step-by-step explanation:

A median is the segment drawn from the vertex of a triangle that bisects the opposite side.

FreshmenSophomoreJuniors464Below, the two-way table is given for aclass of students.Seniors TotalMale2 2Female 36 3TotalIf a student is selected at random, find theprobability the student is a junior given that it'smale. Round to the nearest whole percent.[?]%

Answers

Solution

Step 1

Write out the expression for the probability of an event occurring

[tex]Pr(\text{ event occurring)}=\frac{Number\text{ of required events}}{\text{Total number of events}}[/tex]

For this question,

The number of required events = The number of students that are male and Junior= 2

The total number of events = The total number of male students= 4+6+2+2 = 14

Step 2

Find the required probability after substitution

[tex]Pr(\text{student }is\text{ a junior given its male) =}\frac{2}{14}=\frac{1}{7}[/tex]

Hence the probability the student is a junior given its a male = 1/7

In percentage, the probability will be

[tex]\begin{gathered} \frac{1}{\frac{1}{7}}=\frac{100}{x} \\ \text{x =}\frac{1}{7}\times100 \\ \text{x = 14.29\%} \end{gathered}[/tex]

Where x is the required percentage, to the nearest whole percent, the final answer is 14%

10, 15, 24, 24, 25, 30 What is the mode?

Answers

Mode means the number that appears most.

The answer is 24 since it appears twice.

If 180° ≤ ≤ 270 and S(A) = −4 then determine the exact values of cos(A) and tan(A)

Answers

Recall the definition of the sine of an angle on a right triangle:

[tex]\sin (A)=\frac{a}{c}[/tex]

On the other hand, according to this diagram, the values for tan(A) and cos(A) are given by:

[tex]\begin{gathered} \cos (A)=\frac{b}{c} \\ \tan (A)=\frac{a}{b} \end{gathered}[/tex]

Since 180≤A≤270, the right triangle that corresponds to the angle A on the coordinate plane looks as follows:

Where a and b are negative distances.

Since sin(A)=-4/7, we can assume that a=-4 and c=7. Use the Pythagorean Theorem to find the exact value of b:

[tex]\begin{gathered} a^2+b^2=c^2 \\ \Rightarrow(-4)^2+b^2=7^2 \\ \Rightarrow16+b^2=49 \\ \Rightarrow b^2=49-16 \\ \Rightarrow b^2=33 \\ \Rightarrow|b|=\sqrt[]{33} \end{gathered}[/tex]

We know that b should be negative. Then:

[tex]b=-\sqrt[]{33}[/tex]

Substitute b=-sqrt(33) and c=7 to find the exact values for cos(A) and tan(A):

[tex]\begin{gathered} \cos (A)=-\frac{\sqrt[]{33}}{7} \\ \tan (A)=\frac{-4}{-\sqrt[]{33}}=\frac{4\cdot\sqrt[]{33}}{33} \end{gathered}[/tex]

Therefore, the exact values for cos(A) and tan(A) are:

[tex]\begin{gathered} \cos (A)=-\frac{\sqrt[]{33}}{7} \\ \tan (A)=\frac{4\cdot\sqrt[]{33}}{33} \end{gathered}[/tex]

help meeeeeeeeeeeeeee pleaseeeeeee

Answers

Answer: Width = 5.7 feet, Length = 10.5 feet

Step-by-step explanation:

Let the width be w. Then, the length is 2w-0.9.

[tex]w(2w-0.9)=59.85\\\\2w^2 -0.9w-59.85=0\\\\w =\frac{-(-0.9) \pm \sqrt{(-0.9)^2 -4(2)(-59.85)}}{2(2)}\\\\w =5.7\\\\\implies 2w-0.9=10.5[/tex]

in a video store,a DVD that usually sells for $15 is marked 10% OFF that price. How much does the DVD cost now that it's on sale?

Answers

Answer

The cost of the DVD now that it's on sale will be $13.5​

Explanation

DVD actual price = $15

10% off the price will be (10/100 x $15) = $1.5

The selling price of the DVD now will be $(15 - 1.5) = $13.5

The cost of the DVD now that it's on sale will be $13.5​

8. Draw the graphs described below and answer the question for each.A. Draw the graph of a line with undefined slope. Write the equation of the line youdrew.B. If you wrote the first letter of your LAST NAME (upper-case letter) on a coordinateplane, would it be a function? Make a sketch and provide an explanation as to how youdetermined whether it is a function or not.

Answers

Question:

Draw the graphs described below and answer the question for each.

A. Draw the graph of a line with an undefined slope. Write the equation of the line you drew.

B. If you wrote the first letter of your LAST NAME (upper-case letter) on a coordinate plane, would it be a function? Make a sketch and provide an explanation as to how you determined whether it is a function or not.

Solution:

A.

Remember that any line that has an undefined slope is a vertical line, that has no y-intercept. Therefore the equation of a line with an undefined slope is x = a, where a = x-intercept.

we can conclude that the correct answer is:

According to this information, we can take the following equation for a line with an undefined slope:

[tex]x=5[/tex]

and its graph would be:

B. Remember that a simple visual way to determine if a particular graph is a function is by imagining vertical lines passing through it. If the vertical line touches more than once, it is not a function.

For example, consider the curve that represents the letter O:

And notice that the above curve is a circle and note also the following fact:

We can conclude that the correct answer is:

The curve of the letter O is not a function, since a line intersects at two points of this line.

Use distributive property and combining like terms to simplify.
5x-4y+2(y+x)

Answers

The simplified form is 7x - 2y.

Distributive property: What Is It?

This property states that multiplying the total of two or more addends by a number will produce the same outcome as multiplying each addend by the number separately and then adding the results together.

According to question,

5x-4y+2(y+x)

5x-4y+2y+2x

7x-2y

Hence, simplified form is 7x - 2y.

Learn more about simplified form on:

https://brainly.com/question/10764460

#SPJ1

Point D (8,2) is reflected across the y-axis to form point E.

What are the coordinates of point E?

Answers

Point E would be (-8,2) Due to the reflection, Whenever you reflect on the y or x axis you move the original coordinates to the quadrant that you reflected on, Also The X axis coordinates go first then the Y axis coordinates go last in the ordered pair I have no idea if this helped but yw :D.

Consider the series. 16+24+36+54+...Does the series converge or diverge?

Answers

Explanation

We are asked to determine if the given series converge or diverge

A series is said to be convergent when it approaches a certain value as the series approaches infinity.

To check, we will have this re-written as

[tex]\sum _{n=0}^{\infty \:}16+24+36+54+\ldots \quad :\quad \sum _{n=0}^{\infty \:}-32\left(1-\left(\frac{3}{2}\right)^n\right)[/tex]

Every infinite sum of a non-zero constant diverges

Therefore, the series diverges

Other Questions
What are the leading coefficient and degree of the polynomial?12 20u-u?Leading coefficient:x 5?Degree: A series circuit has more than one path for the electric current to follow true or false q (3.2r 7)Write an equivalent expression by combining like terms The measure of z (4x-5) if x=7 find the measure of z then classfiy then angle What is the difference between discrete and continuous data set? kiruiand kariuki formed a trading partnership .in the first month kirui contributed 1/12 of his salary towards the cost of the company kariukis contribution was 1/10 of his monthly salary giving a total of ksh 980 .their respective contributions the following month were 1/8 and 1/6 of their salaries .if a total contribution for the second month was cash 1550, what were their monthly salaries Community service can provide tremendous benefits not only for the organization receiving the help but the volunteer providing the help, too. Subtract 5y^2-6y-11 from 6y^2+2y+5? 15) Which is an example of an underwater artifact? A) Skeletons found from a dig siteB) A child's toy found from the TitanicC) D) Bones found on top of a mountainPLEASE HURRY BECAUSE THIS IS FOR A TEST!!!!!! A boat with initial position (5i -2j+ 4k) metres relative to port, acceleratesuniformly from initial velocity (4i+ j-3k) m s^-1, for 8 seconds until reaching finalvelocity (12i-7j+13k) m s^-1.a)Find the position of the object after 8 seconds.b) Find the acceleration of the object. What number must be added to the expression below to complete thesquare?x-xO A. -1/14O B. /O C. - 12/2O D.-12 Which of the following was not one of the main reasons colonists chose to remain loyal to the British crown?A) possible economic ruinB) fear of consequences and anarchyC) religious and moral reasonsD) mistreatment in the colonies 9.03 divided by 0.3 does the number line below present the solution to the equivalent X < -1? Use the image to identify how vibrations travel throughthe different ear structures.First, a sound waves enters the _____ in the outer ear.Then, the sound wave vibrates the _____ which connects to the hammer.The first of the tiny bones in the middle ear is the hammer, which vibrates the ______The last of the tiny bones in the middle ear strikes the ______which is found in the inner ear. Business is projected to be booming afterthe latest release of The Fast and theFurious 3.14159265359... Carver's AutoCustom must determine how many cansof paint and rims to stock at theirShanghai location.The Carver Family did choose WarehouseSpace A. The warehouse includes 8000sq. ft. of showroom and workshop space.One half of this warehouse space will beused to stock paint cans and rims. Thewarehouse has a height of 20 ft.Calculate the maximum numberof cylindrical paint cans thatCarver's Auto Custom can stock,if the paint comes in a 2-packhazmat box that measures 15 A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write the mRNA that would be transcribed from this DNA fragment.b) Circle the starter and the stopper in your mRNA sequence. Write the sequence of amino acids which would be encoded in translation. Use the mRNA codon table provided.c) Where in the cell do transcription and translation occur? Show your steps when solving the problem below. Container A has 800 mL of water and is leaking 6 mL per minute. Container B has 1,000 mL of water and is leaking minute. How many minutes will it take for the two containers to have the same amount of water? "For theWhich is a minor claim that should not be included ina summary? in the history of slavery in western civilization, the basic patterns of slavery were not racialized until?