A. Scientific name: Taraxacum officinale
B. Identification: Single, unbranched yellow flower, leaves that grow from the bottom of the stem only(basal leaves); lobed leaves and produce a milky sap; hollow stems
C. Mostly resides on Earth: native to Eurasia but widespread throughout much of temperate North America.
E. Role in the food chain/web: Producers
F. Biomes where it lives in: grassy biome.
G. Trophic level: level 1
Dandelion has the scientific name Taraxacum officinale (the most common species). They have a single, unbranched yellow flower, lobed leaves, and produce a milky sap that grows from the bottom of the stem only (basal leaves) and hollow stems. This plant is in the trophic level 1 where it plays as the primary producer. It mostly resides native to Eurasia but is widespread throughout much of temperate North America. It grows abundantly in the grassland biome.
you have identified a receptor in a pathway that you are studying. the next relay protein in the pathway is phosphorylated on a tyrosine to activate it. how can you determine if the receptor is a rtk or a tk-associated receptor?
Typically, the receptor kinase protein has a transmembrane domain. The non-receptor tyrosine kinase, though, lacks a transmembrane domain.
What distinguishes receptor tyrosine kinases from G protein-coupled receptors?The main distinction between receptor tyrosine kinases and G protein coupled receptors is that the former can only cause one cell response from a single ligand binding, whereas the latter can cause multiple cell responses from a single ligand binding.
A RTK, is HER2?As a transmembrane RTK, HER2 is activated upon dimerization with another receptor from the epidermal growth factor family, such as EGFR (ERBB1), ERBB3 (HER3), and ERBB4 (HER4).
To know more about receptor visit:-https://brainly.com/question/29343237
#SPJ4
List 3 other species that would be in the same trophic level as the warthog
A lion, a crocodile, and a wild dog.
during gene expression, when dna is being transcribed into rna, the non-coding sections are removed. the remaining coding segments are connected. this process is called
As DNA is being translated into RNA during gene expression, the non-coding regions are cut out by a procedure known as RNA splicing.
What does place when DNA gets translated into RNA?In the nucleus, transcription occurs. It constructs an RNA molecule from a template made of DNA. Translation takes place when RNA travels from the nucleus to a ribosome in the cytoplasm. A protein is created during translation by reading the genetic code in mRNA.
What happens when you're transcribing?The information contained in a gene's DNA is transferred to RNA (ribonucleic acid), a molecule comparable to DNA, in the cell nucleus during transcription. Both RNA and DNA are composed of a series of units known as nucleotides.
To know more about rna visit:-
https://brainly.com/question/20914096
#SPJ4
5 functions of mesophyte
Answer: Find your 5
Explanation:
Mesophytes generally require a more or less continuous water supply. They usually have larger, thinner leaves compared to xerophytes, sometimes with a greater number of stomata on the undersides of leaves. Because of their lack of particular xeromorphic adaptations, when they are exposed to extreme conditions they lose water rapidly, and are not tolerant of drought. Mesophytes are intermediate in water use and needs. These plants are found in average conditions of temperature and moisture and grow in soil that has no water logging. The roots of mesophytes are well developed, branched and provided with a root cap. The shoot system is well organised. The stem is generally aerial, branched, straight, thick and hard. Leaves are thin, broad in middle, dark green and of variable shape and measurement.[citation needed]For example, in hot weather they may overheat and suffer from temperature stress. They have no specific adaptations to overcome this, but, if there is enough water in the soil to allow this, they can increase their rate of transpiration by opening their stomata, thus meaning some heat is removed by the evaporating water. However these plants can only tolerate saturated soil for a certain amount of time without a warm temperature. In dry weather they may suffer from water stress (losing more water via transpiration than can be gained from the soil). Again they have no specific adaptations to overcome this, and can only respond by closing their stomata to prevent further transpiration. This does actually have some benefits as it reduces the surface area of the leaves exposed to the atmosphere, which reduces transpiration. Prolonged periods of dehydration, however, can lead to permanent wilting, cell plasmolysis, and subsequent death. Since mesophytes prefer moist, well drained soils, most crops are mesophytes. Some examples are corn (maize), cucurbits, privet, lilac, goldenrod, clover, and oxeye daisy
How did the phytoplankton change during the El Nino events of 1992-93, 1997-98, and 2015-16?
The phytoplankton levels dropped enormously during the El Nino events.
Phytoplankton are the autotrophic organisms of the aquatic habitat. They are the beginners of the aquatic food chains. Phytoplankton belong to the category of algae. The species have the capability of buoyancy and float in the upper regions of the sea where sunlight can reach to them.
El Nino was the phenomenon where the temperature of the sea surface went unusually high. This lead to the occurrence of droughts, floods, and several other calamities. Since the temperature of the sea increased, the conditions turned unfavorable for the blooming of phytoplankton and that is why their population reduced.
To know more about El Nino, here
brainly.com/question/18307318
#SPJ1
A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write the mRNA that would be transcribed from this DNA fragment.b) Circle the starter and the stopper in your mRNA sequence. Write the sequence of amino acids which would be encoded in translation. Use the mRNA codon table provided.c) Where in the cell do transcription and translation occur?
a) In order to transcribe the segment of DNA, it is important to note that this process is important for gene expression as a protein. An enzyme called RNA polymerase moves along the DNA until the end of the gene, releasing the mRNA. The DNA has two strands: one that goes from 5' to 3' direction, and another one that goes from 3' to 5' direction. The one that's used for transcription will always be the 3' to 5' one, so we already have the correct strand to work with, as it is a 3' to 5' strand.
However, the mRNA will be assembled in the 5' to 3' direction. Using the same complementary base-pairing rules as in DNA, we will pair Cytosine (C) with Guanine (G), but as there is no Thymine (T) in RNA, we will pair Adenine (A) with Uracil (U).
Therefore, the sequence o mRNA read in the 5' to 3' direction is:
5' CUAUGGAAACACAUCAGUAGAA 3'
b) The starter codon is the AUG codon of a messenger RNA (mRNA). Therefore, the sequence of amino acids will start to be decoded there.
The stopper codon can be one of the three following options: UAA, UAG or UGA. In this case, we can only find the UAG codon.
The codons, then will be:
AUG GAA ACA CAU CAG UAG
Then, we can say that the amino acids translated will be:
Met Glu Thr His Gln
(Methionine - Glutamine - Threonine - Histidine - Glutamine
c) In eukaryotes, transcription occurs inside the nucleus of the cell and translation occurs in the cytoplasm.
how does the cell membrane work
Answer:
The cell membrane, also called the plasma membrane, is found in all cells and separates the interior of the cell from the outside environment. The cell membrane consists of a lipid bilayer that is semipermeable. The cell membrane regulates the transport of materials entering and exiting the cell.
Explanation:
How has the carbon cycle changed between the Pre-Industrial and Post-Industrial eras?
Answer: It converts corbon to dox
Explanation:
which experimental results would demonstrate that central pattern generators are involved in producing the muscle contractions involved in rhythmic movement?
The experimental result that displayed the central pattern generators' involvement in muscle contractions is that 'an insect in which the sensory afferents from the wings have been cut can fly', which suggests that option C is the right answer.
Central pattern generators are neuronal circuits which when activated produce rhythmic motor patterns such as walking, breathing or flying etc. in the absence of sensory signals. Muscle contraction refers to the activities such as tightening, shortening, or lengthening of muscles when some activity is performed by the body. It is caused due to the information signal received by the brain and then returned back to site of stimuli. The experiments conducted displayed that a deafferented locust could generate rhythmic flight motor patterns in response to non-rhythmic stimulation of the nerve cord.
Learn more about Central pattern generators at:
brainly.com/question/15565886
#SPJ4
To refer to complete question, see below:
Which experimental results would demonstrate that central pattern generators are involved in producing the muscle contractions involved in rhythmic movement?
a. A cat whose cerebral cortex has been removed can walk and run on a treadmill.
b. A cat whose cerebral cortex has been removed has impaired balance on a treadmill.
c. An insect in which the sensory afferents from the wings have been cut can fly.
d. An insect in which the sensory afferents from the wings have been cut has an unusually slow wingbeat frequency.
compare the wave shape of an alligator’s low-frequency mating call with the wave shape of a frog’s high-frequency chorus. How are the shapes different
The comparison of the wave shape of an alligator’s low-frequency mating call with the wave shape of a frog’s high-frequency chorus in the way that their shapes are different is that The high-frequency shapes are relatively close together whereas the low-frequency waves are spaced out.
What is the mating call about?American alligators aren't afraid to make their presence known when they're looking for a mate, and the outcome might sound like a cross between a motorcycle and the loudest snorer ever. An image of a huge male making one of its loud grunting mating sounds is captured on camera.
So, Odorrana tormota and Huia cavitympanum are two species of frogs that are currently recognized for their ability to vocalize at high frequencies, or even partially ultrasonically. Both individuals' hearing systems have been specially modified so they can hear in the high-frequency band.
Therefore, While the high-frequency patterns are closely spaced apart, the low-frequency waves are elongated in both animals.
Learn more about low-frequency from
https://brainly.com/question/21890312
#SPJ1
Prokaryotic cells are much smaller than eukaryotic cells.
Answer:
Yes, Prokaryotic cells are much smaller than Eukaryotic Cells
Explanation:
Generally, Prokaryotic Cells are smaller as they contain less genetic material and other mechanisms to maintain that material.
Question 4
Below is the CODING STRAND of a small gene that codes for a peptide. Assume the gene has a
traditional start codon.
How many amino acids long is the peptide if we assume traditional start and traditional stop
codon?
5' AATCCGTATCTATGACCGTTTGGAAACACTAAGCGGTACTC 3'
3
5
6
9
Transcription is mRNA synthesis, which occurs by complementing a segment of the DNA template strand. The translation is the protein growth, which occurs by adding amino acids coded by mRNA codons. C) the polypeptide is 6 amino acids long.
What are transcription and translation?The whole process of protein synthesis includes Transcription and translation.
TRANSCRIPTION
Transcription is the mRNA synthesis process and occurs in the nucleus.
The DNA template strand is read in direction 3'→ 5' to build the mRNA molecule in direction 5'→ 3'. The template strand is the one that is going to be complemented by the mRNA.
mRNA molecule has the same sequence as the DNA coding strand, but it carries uracil instead of thymine.
TRANSLATION
Translation is the process through which polypeptide grows. It occurs in the cytoplasm.
rRNA and tRNA read mRNA in the direction 5'→ 3' and add the correct amino acids to build the new protein.
Amino acids are coded by mRNA codons. Protein synthesis initiates in the AUG start codon -Metionin- and ends when reaching either of the stop codons UAA, UAG, or UGA.
In the exposed example, we have a DNA strand. We know that it is the coding strand, so it has the same sequence as mRNA molecule.
DNA coding strand5' AATCCGTATCTATGACCGTTTGGAAACACTAAGCGGTACTC 3'
mRNA molecule5' AAUCCGUAUCUAUGACCGUUUGGAAACACUAAGCGGUACUC 3'
Kowing mRNA sequence, we can grow the protein.
So first, we need to find the initiation codon (AUG), begining from the mRNA 5' extreme. Then we need to find a stop codon (UAA, UAG, or UGA).
mRNA start codon5' AAUCCGUAUCUAUGACCGUUUGGAAACACUAAGCGGUACUC 3'
mRNA stop codon5' AAUCCGUAUCUAUGACCGUUUGGAAACACUAAGCGGUACUC 3'
So this protein begins in AUG and ends in UAA.
To grow the protein, we need to separate mRNA codons and find the corresponding amino acids.
mRNA codons ⇒ AUG ACC GUU UGG AAA CAC UAA amino acids ⇒ Met Thr Val Trp Lys His Stop Protein ⇒ Met-Thr-Val-Trp-Lys-HisAccording to this reasoning, the polypeptide is 6 amino acids long. Option C) is correct.
You can learn more about protein synthesis at
https://brainly.com/question/16305501
#SPJ1
typically, how many molecules of atp (or gtp) are produced by the tca cycle from each molecule of glucose that is completely oxidized to 6 co2 molecules?
The TCA cycle typically generates 2 molecules of ATP (or GTP) from each molecule of glucose that is totally oxidized to 6 co2 molecules.
What makes something a molecule?Its original definition, "the smallest unit of a substance that yet preserves the qualities of that substance," was intended to be encompassed by this designation. An atom is a body that cannot be divided into two, and a molecule is the tiniest unit of a certain material, according to James Maxwell's definition from 1873.
Molecule is it an atom?A molecule is a cluster of two or more atoms that can be divided into smaller recognizable units while still retaining the chemical make-up and physical characteristics of a pure material.
To know more about molecule visit :
https://brainly.com/question/14362857
#SPJ4
Given that propane has carbon in it, do you think that water could be the only product from the burning of propane? Why or why not?
No. Water cannot be the only product of the combustion of propane because carbon dioxide is also formed simultaneously.
Combustion of propaneGenerally, hydrocarbons undergo combustion reactions with oxygen. When this happens, complete combustion leads to the production of carbon dioxide and water. The general equation for the combustion of hydrocarbons is written as: [tex]C_nH_{2n+2} + (3n+1)/2 O_2 = n CO_2 + (n+1) H_2O[/tex]
Propane is a hydrocarbon with the chemical formula, [tex]C_3H_8[/tex]. Thus, when it burns in oxygen, the equation of the reaction becomes:[tex]C_3H_8 + 5O_2 -- > 3CO_2 + 4H_2O[/tex]
From this equation, we can see that not only water is produced when propane burns in oxygen, but carbon dioxide molecules as well. Thus, water cannot be the only product of propane combustion because another product, carbon dioxide, is also formed.
More on propane combustion can be found here:
https://brainly.com/question/3014094
#SPJ1
What tissue does a arctic fox have please ghelp
Answer: Epithelial Tissues
two (2) ways in which octopuses are considered one of the most intelligent animals that exist in our world today.
Some ways in which octopuses have shown their intelligence in labs has been by completing various maze and opening tricky traps to acquire food rewards.
Octopuses are deep sea creatures who are well known for their 8 suction cups lined limbs along with their bulbous head and ink-secreting mechanism.
Of all the invertebrates octopuses are considered to be the most intelligent creatures.
They have a complex system of neurons that together act as a brain. This allows the octopus to perform various tasks such as touching animals and manipulating its surroundings or smell.
Apart from this all of the octopus's 8 arms can be moved independently from each other.
Some ways in which octopuses have shown their intelligence in labs has been by completing various maze and opening tricky traps to acquire food rewards.
Learn more about octopuses at:
brainly.com/question/26814725
[Anatomy, muscles] On the pinky side, to bring back to anatomical position, from a clenched fist
(The answer is 3 words long, it must fit in the spaces I drew in the image)
Between the hand's bones is where the interossei muscles start. There are three palmar interossei and four dorsal interossei. The dorsal interossei allow us to stretch our fingers apart whereas all interossei bend the MCP joints. The interossei on our palms bring our fingers together.
The first and secondhand bones serve as the origin of the greatest dorsal interosseous muscle. When a patient has severe cubital tunnel syndrome because of ulnar nerve injury, it is frequently the first muscle to shrink. It creates the shape between the thumb and index finger when looking at the top of the hand. It draws the thumb towards the index finger as well as dragging the index finger away from the middle finger.
To know more about muscles visit:
https://brainly.com/question/9883108
#SPJ1
Need some help figuring out the basis of this
Demonstrate your understanding of marine plankton, microbes, plants, and algae by creating two job postings or resumes. These should include how those organisms are important to their ecosystems. See the assignment details for further instructions.
Look at DNA, a polymer, and nucleotide, a monomer, on the nucleic acid page. There are sugar molecules within these structures. How many sugar molecules are in DNA and the nucleotide?
Answer: 1 sugar molecule
Explanation:
The basic building block of DNA is called a NUCLEOTIDE. A nucleotide is made up of one sugar molecule, one phosphate molecule and one of the four bases.
Select ALL the correct answers. Based on these images, what can you say about the tentacles of an octopus and the limbs of a lizard? Group of answer choices They’re homologous structures. They’re neither homologous nor analogous structures. They’re neither vestigial nor homologous structures. They’re vestigial structures. They’re analogous structures.
Tentacles of an octopus as well limbs of a lizard are analogous structures.
Analogous structures or organs perform the same function in different organisms that bear no resemblance to each other anatomically. Analogous structures are formed as a result of convergent evolution, i.e. different structures evolving for the similar function and thus having similarity. Tentacles of an octopus as well as limbs of a lizard are used for the similar function, i.e. locomotion in this case.
On the other hand, homologous structures result from divergent evolution. Homologous organs contain a similar basic structure but perform distinct functions in different organisms.
To learn more about Homologous organs here
https://brainly.com/question/14963404
#SPJ1
what problem is faced by organisms that live in fresh water? what problem is faced by organisms that live in fresh water? without compensating mechanisms, their bodies tend to take in too much water. they will have higher concentrations of body solutes than organisms that live on land. their bodies tend to lose too much water to their environment. they have no way of controlling their tonicity.
Problems faced by organisms that live in freshwater are without compensating mechanisms, their bodies tend to take in too much water.
Their bodies have a tendency to absorb too much water since freshwater organisms' environments are hypotonic in nature to their cells, which causes the organisms' bodies to do the same. They are unable to manage their tonicity. Only saltwater causes issues for the creatures who inhabit it.
The osmotic principle states that water travels from a location of low solute concentration (hypotonic) to a region of high solute concentration (hypertonic). As a result, the low solute content in the water creates difficulty for freshwater creatures since they have a tendency to use too much water.
To learn more about Freshwater visit: https://brainly.com/question/3759176
#SPJ4
Given that propane has hydrogen in it, do you think that carbon dioxide could be the only product from the burning of propane? Why or why not?
No. Carbon dioxide cannot be the only product of the burning of propane. Water is also produced.
Combustion of hydrocarbonsGenerally, hydrocarbons undergo combustion reactions with oxygen. When this happens, complete combustion leads to the production of carbon dioxide and water.
The general equation for the combustion of hydrocarbons is written as: [tex]C_nH_{2n+2} + (3n+1)/2 O_2 = n CO_2 + (n+1) H_2O[/tex]
Propane is a hydrocarbon with the chemical formula, [tex]C_3H_8[/tex]. Thus, when it burns in oxygen, the equation of the reaction becomes:
[tex]C_3H_8 + 5O_2 -- > 3CO_2 + 4H_2O[/tex]
From this equation, we can see that not only carbon dioxide is produced when propane burns in oxygen, but water molecules as well.
Thus, carbon dioxide cannot be the only product of propane combustion because another product, water, is also formed.
More on propane combustion can be found here: https://brainly.com/question/3014094
#SPJ1
all fuels are sources of energy
Answer:
they are usually considered to be a primary energy source.
Explanation:
Volume can be measured in liters or cubic meters.
Please select the best answer from the choices provided
OT
OF
Answer:
The correct answer option is True.
Explanation:
Volume can be measured in liters or cubic meters - it is true.
The measure of the amount of space which an object or a substance can occupy is said to be its volume.
The basic unit of volume in the metric system is a liter while the SI unit of the volume is the cubic meter.
Therefore, the given statement is true.
Match the terms regarding the subhylum Vertebrata to their correct phase of definition.
• Axial Skeleton,: A division of the skeleton consisting of the skull, thoraz and vertebral column
,• Appendicular Skeleton,: A division of the skeleton composed of the girdle and limb bones
,• Oviparous,: These organisms lay eggs that develop and hatch outside the mother.
,• Viviporous,: These organisms nourish their offspring inside the mother during development and give birth to live young.
,• Ovoviviparous,: These organisms carry their young in eggs inside the mother, when the eggs hatch, the mother gives birth to live young.
How did Nautiluses developed jet propulsion. Why was it envolutionarily beneficial?
Please hurry, this is for Zoology under the Mollusca section
Answer:
Nautiluses made this development through years of evolution. They developed jet propulsion to help them to better outswim predators.
Explanation:
This is my answer, not a sample answer. Hopefully, it helps! :)
Fill in the blanks need explanationVolcanic eruptions has ______ and _____ effect on the environment
The volcanic eruptions has the release of volcanic gas and it provoke climate changes that has a negative effect on the environment.
18. As part of an experiment, a light source is placed next to a plant. After a few days, the plant is growing toward
the light. The light acted as a(n)..
a. stimulus
b. response
c. growth
d. defense
Answer:
The answer is A, stimulus
6. Analyze How can the introduction of nutria affect a pond ecosystem food web?
The introduction of nutria affects a pond ecosystem food web because the saltwater marshes are destroyed by Nutria's ravenous eating habits.
Nutria's ravenous appetite for food causes the destruction of saltwater marshes, which reduces the amount of food and shelter available to other species and promotes severe erosion.
By devouring the wetland grasses, Nutria devastates the area's food chain and environment. A few invasive species seriously hurt the economy. The amount of above- and below-ground plant matter that nutria consume daily can reach up to 25% of their body weight.
Nutria obliterates the banks of ditches, lakes, and other bodies of water in addition to harming vegetation and agriculture. What's most important, though, is the long-term harm that nutria may do to wetlands like marshes.
To learn more about Nutria visit: https://brainly.com/question/17690670
#SPJ9
What is the relationshiop between the inputs and outputs of photosynthesis?
The inputs and outputs have the same number of atoms on both sides of the
equation for photosynthesis.
The more molecules that are input into photosynthesis, the more output can be
produced.
The inputs and outputs have the same type of atoms (carbon, hydrogen and
oxygen) on both sides of the equation for photosynthesis.
All of the above.
Answer:
Photosynthesis is when a plant is absorbing water, sunlight, for its energy, This means that your answer is the inputs and outputs have the same type of atoms
Answer:
If you are talking about the 5.03 Photosynthesis Gizmo Quiz, the answer is D. all of the above.
Explanation: