I need help I’ve been having trouble with this chapter for about a week

I Need Help Ive Been Having Trouble With This Chapter For About A Week

Answers

Answer 1

Given:

[tex]3x^2+20x+33[/tex]

Find-:

Factorization of the equation.

Sol:

A simple method of factorization is to multiply in first and last order then break it down into parts to make the middle number then.

[tex]\begin{gathered} =3\times33 \\ =99 \end{gathered}[/tex]

The factor of 99 is:

So take factor :

[tex]\begin{gathered} 11\text{ and \lparen3}\times3) \\ \\ 11\text{ and 9} \end{gathered}[/tex]

Factorization of the equation is:

[tex]\begin{gathered} =3x^2+20x+33 \\ \\ =3x^2+11x+9x+33 \end{gathered}[/tex]

I Need Help Ive Been Having Trouble With This Chapter For About A Week

Related Questions

What is the equation of the circle whose diameter has endpoints (10,1) and (-8,1)

Answers

Since the endpoints of the diameter are (10, 1) and (-8, 1)

Then the center of the circle is the midpoint of these 2 points

We will use the rule of the midpoint to find the center

[tex]M=(\frac{x_1+x_2}{2},\frac{y_1+y_2}{2})[/tex]

[tex]\begin{gathered} M=(\frac{10+-8}{2},\frac{1+1}{2}) \\ \\ M=(\frac{2}{2},\frac{2}{2}) \\ \\ M=(1,1) \end{gathered}[/tex]

The center of the circle is (1, 1)

The length of the diameter is the difference between the x-coordinate

Suppose you and a friend are playing a game that involves flipping a fair coin 3 times. Let X = the number of times
that the coin shows heads. You have previously shown that all conditions have been met and that this scenario
describes a binomial setting.
Determine the value of n and p and calculate the mean and standard deviation of X. Round the standard deviation to
three decimal places.
■ n=


p=
Hx=
0x =
h
Done

Answers

The given solutions are:

n = 3

p = 0.5

mean Hx= 1.5

standard deviation 0x = 0.866

How to solve the probability

The value of n = 3

The fair coin is said to have been flipped 3 times

P = 0.5

The coin has two faces, the probability of either face would be 1 / 2

= 0.5

Next we have to solve for the mean of x

μ[tex]_{x}[/tex] = n * p

= number * probability

= 0.5 * 3

= 1.5

The standard deviation

σ[tex]_{x}[/tex] = [tex]\sqrt{np(1-p)}[/tex]

= √1.5(1-0.5)

= √1.5*0.5

= √0.75

= 0.866

Read more on mean and standard deviation here: https://brainly.com/question/24298037

#SPJ1

If the ratio of m to nis 7 to 6which of the following could be true?

Answers

m = 7/3, n = 2​ could be true if the m/n ratio is 7:6. Option-E is correct.

Given that,

Which of the following could be true if the m/n ratio is 7:6.

Option are

A. m = 8, n = 7

B. m = 12,n= 14

C. m=14, n=0

D. m = 42, n = 42

E. m = 7/3, n = 2​

Comparing two amounts of the same units and determining the ratio tells us how much of one quantity is in the other.

Consider each of the m and n values that are provided.

Option-A

m:n = 8:7 ≠ 7 : 6

Option-B

m:n = 12:14 = 6:7 ≠ 7 : 6

Option-C

m:n  = 14:0 ≠ 7 : 6

Option-D

m:n = 42:42 = 1:1 ≠ 7 : 6

Option-E

m:n  = 7/3 : 2 = 7 : 6

Thus E is the only true ratio

Therefore, m = 7/3, n = 2​ could be true if the m/n ratio is 7:6.

To learn more about ratio visit: https://brainly.com/question/13419413

#SPJ9

determine if the rate 8 cups with 56 Forks in 4 cups with 28 Forks are equivalent

Answers

Divde the number of cups by the number of forks

8 cups to 56 forks = 8 /56 = 0.14

4 cupts to 28 forks = 4 /28= 0.14

Both are rates are equivalent

Distributive property to solve-4(s-4)

Answers

The distributive property can be applied in the following form:

[tex]a(b-c)=a\times b-a\times c[/tex]

Now, the given values are: a=-4, b=s and c=4.

Let's replace them in the equation and solve:

[tex]\begin{gathered} -4(s-4)=(-4)\cdot(s)-(-4)\cdot(4) \\ By\text{ the law of signs -}\cdot-=+and-\cdot+=-\text{ thus:} \\ -4(s-4)=-4s+16 \end{gathered}[/tex]

Then, the answer is -4s+16

The points ​(2​,​11) and ​(6,​33) form a proportional relationship. Find the slope of the line through the points. Then use the slope to graph the line.

Answers

The slope (m) of the line using the given coordinates is 11/2 and the equation of the slope is plotted on the graph.

What do we mean by slope?The value of the steepness or the direction of a line in a coordinate plane is referred to as the slope of a line, also known as the gradient. Given the equation of a line or the coordinates of points situated on a straight line, a slope can be determined using a variety of approaches.A line's steepness can be determined by looking at its slope. The slope is calculated mathematically as "rise over run" (change in y divided by change in x).

So, the slope formula is:

m = y₂ - y₁/x₂ - x₁

Now, put the values and calculate as follows:

m = 33 - 11/6 - 2m = 22/4m = 11/2

So, the slope equation will be:

y = mx + by = 11/2x + b

Now, plot the graph of the equation, taking b = 1.

(Refer to the graph attached below)

Therefore, the slope (m) of the line using the given coordinates is 11/2 and the equation of the slope is plotted on the graph.

Know more about slopes here:

https://brainly.com/question/3493733

#SPJ1

For triangle XYZ, m∠X = 38°, m∠Y = (5x − 11)°, and m∠Z = (4x − 45)°. Find m∠Y.

m∠Y = 22°
m∠Y = 43°
m∠Y = 99°
m∠Y = 158°

Answers

The measure of angle Y from triangle XYZ is 99°. Therefore, option C is the correct answer.

Given that, in ΔXYZ, m∠X = 38°, m∠Y = (5x - 11)°, and m∠Z = (4x - 45)°.

What is angle sum property of a triangle?

Angle sum property of triangle states that the sum of interior angles of a triangle is 180°.

Using angle sum property of triangle, we get

m∠X+m∠Y+m∠Z=180°

⇒ 38°+(5x - 11)°+(4x - 45)°=180°

⇒ 9x+38-11-45=180

⇒ 9x-18=180

⇒ 9x=180+18

⇒ 9x=198

⇒ x=22°

So, m∠Y = (5×22 - 11)°

=110-11

= 99°

The measure of angle Y from triangle XYZ is 99°. Therefore, option C is the correct answer.

To learn more about the angle sum property of a triangle visit:

https://brainly.com/question/8492819.

#SPJ1

[tex]y {}^{2} + 5y - 24[/tex]Help to do this problem by Factoring triinomials by Box Method. please

Answers

Factor the trinomial

[tex]y^2+5y-24[/tex]

by the box method.

The multiplication gives -24y^2. Now we need to find two factor that gives 5x. It should be creal that this factor are 8y and -3y. Then:

Now we find the common factor for each column and row:

Therefore:

[tex]y^2+5y-24=(y-3)(y+8)[/tex]

A desk is on sale for $380, which is 20% off the original price. Which equation can be used to determine theamount of money saved, s, in dollars, when purchasing this desk on sale?A s= 0.2(380)BS = (380 = 0.8) - 380Cs= (380 = 0.5) – 380D8 = (380 = 0.8)

Answers

Since the desk was 20% off, the price of $380 represents 80% of the original price.

Step 1. Define an expression to find the original price.

To find this original price, we divide the discounted price of 380 by the percentage it represents: 0.8 (we represent 80% in decimal form as 0.8)

[tex]380\div0.8[/tex]

That expression represents the original price.

Step 2. To find the amount saved, we subtract the sale price to the original price:

[tex]s=(380\div0.8)-380[/tex]

This expression will give as a result the amount saved s.

Answer:

[tex]s=(380\div0.8)-380[/tex]

Find the volume of this cone.Use 3 for TT.V = Tigh3Hint: The radius (1) is1/2 of the diameter.6 ft6 ft-3V ~ [?]ft

Answers

ANSWER

[tex]54ft^3[/tex]

EXPLANATION

The volume of a cone is given by:

[tex]V=\frac{\pi r^2h}{3}[/tex]

where r = radius

h = height

The height of the given cone is 6 ft and its diameter is 6 ft. The radius of a cone is half its diameter, hence its radius is:

[tex]\begin{gathered} r=\frac{6}{2} \\ r=3ft \end{gathered}[/tex]

Hence, the volume of the cone is:

[tex]\begin{gathered} V=\frac{3\cdot3^2\cdot6}{3} \\ V=54ft^3 \end{gathered}[/tex]

That is the answer.

This is homework the answers are (1/2) (2) (0) (4)

Answers

Given:

Given a line.

To determine the slope, we use the formula:

Next, we select the points based on the give line:

We plug in what we know:

Therefore, the slope is 2.

Evaluate the piecewise defined function for the given values of x.F(x)= -x -1 for x<-1, -3 for -1≤x<2, √x-2 for x≥2A. f(-3)B. f(-1)C. f(2)D. f(6)

Answers

Answer:

[tex]\begin{gathered} f(-3)=2 \\ f(-1)=-3 \\ f(2)=0 \\ f(6)=2 \end{gathered}[/tex]

Explanation:

Given the piecewise defined function;

[tex]f(x)=\mleft\{\begin{aligned}-x-1for\rightarrow x<-1_{} \\ -3\text{for} \\ \sqrt[]{x-2}\text{ for}\rightarrow x\ge2\end{aligned}\mright.\rightarrow-1\leq x<2[/tex]

a) f(-3)

we want to find the value of f(x) at x=-3.

-3 is less than -1, so it falls within the interval x<-1.

[tex]\begin{gathered} f(x)=-x-1 \\ f(-3)=-(-3)-1 \\ f(-3)=3-1 \\ f(-3)=2 \end{gathered}[/tex]

b) f(-1)

-1 falls with the second interval

[tex]-1\leq x\leq2[/tex]

For this interval, f(x) is always equal to -3.

[tex]\begin{gathered} f(x)=-3 \\ f(-1)=-3 \end{gathered}[/tex]

c) f(2)

2 falls within the last interval.

[tex]\begin{gathered} f(x)=\sqrt[]{x-2} \\ f(2)=\sqrt[]{2-2} \\ f(2)=0 \end{gathered}[/tex]

d) f(6)

6 falls within the last interval.

[tex]\begin{gathered} f(x)=\sqrt[]{x-2} \\ f(6)=\sqrt[]{6-2} \\ f(6)=\sqrt[]{4} \\ f(6)=2 \end{gathered}[/tex]

Excluding hydropower, U.S. power plants used renewable energy sources to generate 105 million megawatthours of electricity in 2007. By 2012, the amount of electricity generated had increased to 219 million megawatthours. Let x represent the time (in years) since 2007 and let y represent the number of megawatt hours (inmillions).Because time x is defined in years since 2007, 2007 corresponds to x = 0 and 2012 corresponds to x = 5. Fnd therate of change (slope) of the use of renewable energy sources between 2007 and 2012.

Answers

In order to calculate the rate of change, we just need to divide the difference in megawatt hours generated between 2007 and 2012 by the period of 5 years.

So we have that:

[tex]\text{rate}=\frac{219-105}{5}=\frac{114}{5}=22.8[/tex]

So the rate of change is 22.8 millions of megawatt hours generated per year.

I need help please!!

Answers

Ok, well, I think I need to the see previous problem. But from the information given, I think the right choices are:

a) tenth

b) 31.8

c) 32

the Santa Ana College theartre department sold 177 tickets to the spring play student tickets were sold for $7 each and general admission ticket were $9 if the total tickets sales were 1365 how many of each type of tickets were sold?

Answers

Let

x -----> number of play student tickets sold

y ----> number of general admission tickets sold

we have that

x+y=177 ------> x=177-y -----> equation A

7x+9y=1365 -----> equation B

solve the system

substitute equation A in equation B

7(177-y)+9y=1365

solve for y

1239-7y+9y=1365

2y=1365-1239

2y=126

y=63

Find the value of x

x=177-63

x=114

therefore

student tickets sold was 114general admission ticket sold was 63

How can you write the expression with a rationalized denominator?See image

Answers

Okay, here we have this:

Considering the provided expression, we are going to rationalize the denominator, so we obtain the following:

[tex]\begin{gathered} \frac{\sqrt[3]{3}}{\sqrt[3]{4}} \\ =\frac{\sqrt[3]{3}\cdot\sqrt[3]{4^2}}{\sqrt[3]{4}\cdot\sqrt[3]{4^2}} \\ =\frac{\sqrt[3]{3}\cdot\sqrt[3]{2^4}}{4^{\frac{1}{3}+\frac{2}{3}}} \\ =\frac{\sqrt[3]{3}\cdot2^{\frac{4}{3}}}{2^2} \\ =\frac{\sqrt[3]{3}\sqrt[3]{2}}{2} \\ =\frac{\sqrt[3]{6}}{2} \end{gathered}[/tex]

Finally we obtain that the correct answer is the second option.

A line has a slope of 8 and passes through the point (1,4). What is its equation in slope-intercept form? Show work

Answers

The equation of the line in slope intercept form is:

y = 8x - 4

Given, we have slope = 8

Point = (1,4)

Equation in slope intercept form is:

y = mx+c

let the point (1,4) ne (x₁,y₁)

and slope (m) = 8

y - y₁ = m(x-x₁)

y - 4 = 8(x - 1)

y - 4 = 8x - 8

y = 8x - 8 + 4

y = 8x - 4

Hence the equation in slope intercept form is y = 8x-4

Learn more about Coordinate geometry here:

brainly.com/question/7243416

#SPJ9

the graph of the functiony=f(x)+34can be obtained from the graph ofy=f(x)by which following action?shifting the graph f(x) to the left 34 unitsshifting the graph f(x) to the right 34 unitsshifting the graph f(x) downwards 34 units shifting the graph of f(x) upwards 34 units

Answers

Given data:

The given expression is f(x)+34.

The given graph can be obtained by shifting f(x) in the positive direction of y by 34 units.

F(x)=f(x)+34

Thus, the last option is correct.

For the function, determine whether y varies directly with x. If so, find the constant of variation and write the function rule.Select the correct choice below and, if necessary, fill in the answer box within your choice.O A. Yes, y varies directly with x. The constant of variation is k = and the function rule is(Simplify your answers. Use integers or fractions for any numbers in the expression)No, y does not vary directly with x.

Answers

Answer: No, y does not vary directly with x

Explanation:

y varies directly with x when y divided by x is always the same constant. In this case, we get:

x y y/x

2 6 6/2 = 3

4 14 14/4 = 3.5

5 17 17/5 = 3.4

Since 3, 3.5, and 3.4 are distinct, the answer is No, y does not vary directly with x.

(2 pts)9. Arielle took a cash advance of $1500. Her new credit card charges a periodic (daily)interest rate of 0.07%.a) How much interest will Arielle pay for the statement for the month of May whichhas 31 days(2 pts)b) What is the balance that she owes?

Answers

Exercise data

$ 1500

Interest rate = 0.07%= 0.07/ 100 = 0.0007

a) How much interest will Arielle pay for the statement for the month of May which

has 31 days?

Simple Interest=P×I×N

where:

P=principle

I=daily interest rate

N=number of days between payments

Interest= 1500 x (0.07/100) x 31 = $ 32.55

another way to write

Interest= 1500 x (0.0007) x 31 = $ 32.55

b)What is the balance that she owes?

Balance = P x ( 1 + I*t) where t= time.

Balance = 1500 x (1 + 0.0007*31)

Balance = 1500 x (1 + 0.217)

Balance = 1500 x (1 .217)

Balance = 1532.55

another way to solve

Balance = P + Interest

Balance = 1500 + 32.55

Balance = 1532.55

2y = 14xDirect variationk =Not direct variation

Answers

2y = 14x

divide both sides by 2

so,

y = 7x

direct variation and k = 7

What fraction is represented in the picture below?

Answers

1 5/16

Your answer should be above.

Answer:

A

Step-by-step explanation:

Which is greater, 1/2 or 2/7?

Answers

If we have two fractions a/b and c/d:

[tex]\frac{a}{b}(\text{ })\frac{c}{d}[/tex]

To determine which one of them is greater we make the cross product:

[tex]ad(\text{ })bc[/tex]

We have 3 cases:

- If ad is greater than bc, then a/b is greater than c/d

- If bc is greater than ad, then c/d is greater than a/b

- If ad is equal to bc, then a/b is equal to c/d

For 1/2 and 2/7:

[tex]\begin{gathered} \frac{1}{2}(\text{ })\frac{2}{7} \\ 7\cdot1(_{\square})2\cdot2 \\ 7>4 \\ \Rightarrow\frac{1}{2}>\frac{2}{7} \end{gathered}[/tex]

I need help question

Answers

The domain is all values of x except 1

the range is all values of y < -1

domain (-∞,1)U(1,∞)

range (-∞,-1)

Choose the greatest multiple of 10 you can multiply by 30 to get close to,
but not go over, 750. Then, write the product.

Answers

Answer:

20, 600

Step-by-step explanation:

[tex]20 \times 30=600 \\ \\ 30 \times 30=900[/tex]

Answer 250 cause 250 is a multiple of 10 times that by 30 is 750

An aquarium is 0.5 feet wide, 1.5 feet tall, and 2 feet long.The bottom is covered with gravel to a height of 3 inches.The tank will be filled with water to 3 inches below the top.How many gallons of water are needed to fill the aquarium?(Use 1 gallon = 0.134 ft.) Ignore any water that might seepinto the layer of gravel. Round to the nearest tenth.

Answers

Step 1: Find the base area of the tank.

The base of the tank is a rectangle of length 2 ft and width 0.5 ft.

Hence,

[tex]\text{ the base area of the tank }=2ft\times0.5ft=1ft^2[/tex]

Step 2: Find the height of the water in the tank.

The height of the tank = 1.5ft

the height of the gravel = 3in = 3/12 ft = 1/4 ft

The water is 3 inches (= 1/4 ft) below the top of the tank.

Hence, we must have that

[tex]\begin{gathered} x+\frac{1}{4}+\frac{1}{4}=1.5 \\ x+0.25+0.25=1.5 \\ x+0.5=1.5 \\ x=1.5-0.5=1\text{ ft} \end{gathered}[/tex]

Therefore, the height of the water in the tank is 1 ft.

Step 3: Find the volume of the water in the tank

[tex]\begin{gathered} \text{ the volume of the water is given by} \\ V=\text{ base area of the tank }\times\text{ height of the water} \\ \text{ Where V is the volume of the water} \end{gathered}[/tex]

Therefore,

[tex]V=1ft^2\times1ft=1ft^3[/tex]

Since 1 gallon is equivalengt to 0.134 ft³ then

[tex]V=\frac{1}{0.134}\text{gallons }=7.5\text{ gallons}[/tex]

Hence, the number of gallons of water are needed to fill the aquarium is 7.5 gallons.

The segments in each figure are tangent to the circle. Solve for x.4x -9AB15DС

Answers

CIRCLE THEOREM: Two tangents drawn from an external point to a circle are equal.

Thus, AB is a tangent to the circle and also BC is another tangent to the circle, both drawn from point B.

AB = BC;

[tex]\begin{gathered} 4x-19=15 \\ 4x=15+19 \\ 4x=34 \\ x=\frac{34}{4} \\ x=8.5 \end{gathered}[/tex]

The value of x is 8.5

Which is equivalent to StartFraction x Superscript 3 Baseline over StartRoot x EndRoot EndFraction?

Answers

[tex]\begin{equation*} \text{ x}^{\frac{5}{2}}\text{ \lparen option C\rparen} \end{equation*}[/tex]Explanation:[tex]\begin{gathered} Given: \\ \frac{x^3}{\sqrt{x}} \end{gathered}[/tex]

We need to re-write x into one exponent:

[tex]\begin{gathered} \sqrt{x}\text{ = x}^{\frac{1}{2}} \\ \frac{x^3}{\sqrt{x}}=\text{ }\frac{x^3}{x^{\frac{1}{2}}} \end{gathered}[/tex]

Simplify:

[tex]\begin{gathered} The\text{ operation between the exponent is division} \\ To\text{ combine the exponents, we will subtract the 1/2 from 3} \\ \frac{x^3}{x^{\frac{1}{2}}}\text{ = x}^{3-\frac{1}{2}} \end{gathered}[/tex][tex]\begin{gathered} =\text{ x}^{\frac{6-1}{2}} \\ =\text{ x}^{\frac{5}{2}}\text{ \lparen option C\rparen} \end{gathered}[/tex]

what is the slope of a passing line through the points(2, 5) and ( o, -4)?

Answers

The slope of the line is 9/2 passing line through the points(2, 5) and ( o, -4)

What is slope ?

A line's slope is how steep it is moving from LEFT to RIGHT. The slope of a line is the ratio of its climb, or vertical change, to its run, or horizontal change. The slope remains consistent regardless of where you choose for the line's starting and finishing locations (it never changes).

Calculation

We know that the formula to find the slope of a line is

m = (y2 - y1) / (x2 - x1)

Where (x1, y1) and (x2, y2) are the points

The points given are (2, 5) and (0, -4)

Substituting it in the formula

m = (-4 - 5)/ (0 - 2)

So we get

m = -9/ -2

m = 9/2

Therefore, the slope of the line is 9/2.

learn more about slope here :

brainly.com/question/3605446

#SPJ1

what do you do in the following problem... "Michael is leaning a 12 foot ladder is leaning against the side of a building. The top of the ladder reaches 10 feet up the side of the building. Approximately how far, to the nearest hundredth, is the bottom of the ladder from the base of the building?"

Answers

Answer:

The distance between the bottom of the ladder to the base of the building = 6.63 feet

Explanations:

The height of the ladder, l = 12 feet

Height of the wall covered by the ladder, h = 10 feet

Distance between the base of the building and the bottom of the ladder = x

Using the pythagoras theorem:

[tex]\begin{gathered} (\text{Hypotenuse)}^2=(opposite)^2+(Adjacent)^2 \\ l^2=h^2+x^2 \\ 12^2=10^2+x^2 \\ 144=100+x^2 \\ 144-100=x^2 \\ 44=x^2 \\ \sqrt[]{44}=\text{ x} \\ x\text{ = }6.63 \end{gathered}[/tex]

The distance between the bottom of the ladder to the base of the building = 6.63 feet

Other Questions
Subtract 5y^2-6y-11 from 6y^2+2y+5? 15) Which is an example of an underwater artifact? A) Skeletons found from a dig siteB) A child's toy found from the TitanicC) D) Bones found on top of a mountainPLEASE HURRY BECAUSE THIS IS FOR A TEST!!!!!! A boat with initial position (5i -2j+ 4k) metres relative to port, acceleratesuniformly from initial velocity (4i+ j-3k) m s^-1, for 8 seconds until reaching finalvelocity (12i-7j+13k) m s^-1.a)Find the position of the object after 8 seconds.b) Find the acceleration of the object. What number must be added to the expression below to complete thesquare?x-xO A. -1/14O B. /O C. - 12/2O D.-12 Which of the following was not one of the main reasons colonists chose to remain loyal to the British crown?A) possible economic ruinB) fear of consequences and anarchyC) religious and moral reasonsD) mistreatment in the colonies 9.03 divided by 0.3 does the number line below present the solution to the equivalent X < -1? Use the image to identify how vibrations travel throughthe different ear structures.First, a sound waves enters the _____ in the outer ear.Then, the sound wave vibrates the _____ which connects to the hammer.The first of the tiny bones in the middle ear is the hammer, which vibrates the ______The last of the tiny bones in the middle ear strikes the ______which is found in the inner ear. Business is projected to be booming afterthe latest release of The Fast and theFurious 3.14159265359... Carver's AutoCustom must determine how many cansof paint and rims to stock at theirShanghai location.The Carver Family did choose WarehouseSpace A. The warehouse includes 8000sq. ft. of showroom and workshop space.One half of this warehouse space will beused to stock paint cans and rims. Thewarehouse has a height of 20 ft.Calculate the maximum numberof cylindrical paint cans thatCarver's Auto Custom can stock,if the paint comes in a 2-packhazmat box that measures 15 A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write the mRNA that would be transcribed from this DNA fragment.b) Circle the starter and the stopper in your mRNA sequence. Write the sequence of amino acids which would be encoded in translation. Use the mRNA codon table provided.c) Where in the cell do transcription and translation occur? Show your steps when solving the problem below. Container A has 800 mL of water and is leaking 6 mL per minute. Container B has 1,000 mL of water and is leaking minute. How many minutes will it take for the two containers to have the same amount of water? "For theWhich is a minor claim that should not be included ina summary? in the history of slavery in western civilization, the basic patterns of slavery were not racialized until? The table shows the highest maximum temperature for the month of October in Philadelphia Pennsylvania over the yearsPart A identify the independent and dependent quantity in their units of measure?Part B identify the equation of line of best fit using the data table.what is the slope and y-intercept of the line and what do they represent? How many times larger is 6 108 than 3 10-4? 7. Solve the following set of equations: 3x - 7y=-4 and 2x - 5y = -3a. (1, 2)b. (2, 1)c. (-2,-1)d. (1, 1)e. (-1,-1) You ordered from an online company. The original price of the item is $65. Theitem is on sale for 10%, and you have a coupon for an additional 15%. Applying onediscount at a time, what is the final price?$46.96$49.73$49.47$45.45 After the end of an advertising campaign, the daily sales of a product fell rapidly, with daily sales given by S=3800e0.05x dollars, where x is the number of days from the end of the campaign.a. What were daily sales when the campaign ended?b. How many days passed after the campaign ended before daily sales were below half of what they were at the end of the campaign? Joseline is trying out a new piece of photography equipment that she recently purchased that helps to steady a camera with one single leg instead of three. What type of equipment is Joseline trying out?A. multi-podB. tripodC. semi-podD. monopod DNA Extraction Lab. 1. Where did the DNA you are seeing come from? (Based on the method given below).