HURRY

Read the section "How to Buy and Sell Stocks." Describe how stocks are purchased by investors.

Answers

Answer 1

Answer:

Answer is below.

Explanation:

According to the question, investors purchase stocks by earning money on the purchase of shares in two ways at the same time: in the event of an increase in the price of the bought securities and of the payments of dividends. Generally, stocks must be bought and sold through an intermediary called a broker, who takes buy orders and purchases them on behalf of the investor. Discount brokers, such as online services that charge minimal fees for stock trading, are a popular way to buy and sell stocks. Although the average person generally invests in the stock market for the long term, hoping that the company's shares will rise over time, many professional investors buy and sell stocks constantly, sometimes even on the same day.In addition to being entitled to income from a share and the potential for profit if the value of the share increases, shareholders benefit from a number of other benefits. On the one hand, shareholders have the right to receive periodic updates on the performance of the company and may be invited to special events for shareholders.

Answer 2

Answer:

its basically the same thing but i changed up some words so it doesn't strike you for plagerism

Explanation:

Investors purchase stocks by earning money on the purchase of shares in two ways at the same time of the event of an increase in the price of the bought securities and of the payments of dividends. Generally, stocks must be bought and sold through an intermediary called a Broker. They take, buy, orders, and purchases them on behalf of the investor. Discount brokers, like online services that charge smaller fees for stock trading, are a popular way to buy and sell stocks. Even though the average person generally invests in the stock market for long term, hoping that the company's shares will rise, many professional investors buy and sell stocks constantly, sometimes even on the same day. In addition to being entitled to income from a share and the potential for profit if the value of the share increases, shareholders benefit from a number of other benefits. But, shareholders have the right to receive periodic updates on the performance of the company and may be invited to special events for shareholders.


Related Questions

How many terms are in this expression?
5d+4+8b
PLZ HELP

Answers

Answer:

3

Explanation:

Answer:

3

Explanation:

33333333333333333333

This centuries old empire, which had become known as "the sick man of Europe" would finally come to an end after being on the losing side of World War I.

A Third Reich

B Roman Empire

C Ottoman Empire

D Ming Dynasty

Answers

Answer:

no se puedes ser mas especifico muchas gracias

How do you think you can apply group work in class to the business and professional world?

Answers

nsnsnd. skdkdkd . kelekdf

As a result of the Battle of Coral Sea, U.S.forces successfully

A captured Japan's largest aircraft carrier.

B. regained control of the Philippines.

C. prevented Japan from invading New Guinea.

D.sunk two ships in Japan's fleet of ships.

Answers

Answer:

Option D sunk two ships in Japan's fleet of ships.Hope this answer helps you

The addition of the 13th Amendment to the United States Constitution in December of 1865..

Question 1 options:

made the Emancipation Proclamation law by ending slavery in America


was supported by most citizens of the former Confederate States of America


gave newly-freed slaves the right to vote


all of the above

Answers

Answer:

The Thirteenth Amendment (Amendment XIII) to the United States Constitution abolished slavery and involuntary servitude, except as punishment for a crime. The amendment was passed by Congress on January 31, 1865, and ratified by the required 27 of the then 36 states on December 6, 1865, and proclaimed on December 18. It was the first of the three Reconstruction Amendments adopted following the American Civil War.

President Abraham Lincoln's Emancipation Proclamation, issued on January 1, 1863, declared that the enslaved in Confederate-controlled areas were free. When they escaped to Union lines or federal forces—including now-former slaves—advanced south, emancipation occurred without any compensation to the former owners. Texas was the last Confederate territory reached by the Union army. On June 19, 1865—Juneteenth—U.S. Army general Gordon Granger arrived in Galveston, Texas, to proclaim the war had ended and so had slavery. In the slave-owning areas controlled by Union forces on January 1, 1863, state action was used to abolish slavery. The exceptions were Kentucky and Delaware where slavery was finally ended by the Thirteenth Amendment in December 1865.

In contrast to the other Reconstruction Amendments, the Thirteenth Amendment has rarely been cited in case law, but has been used to strike down peonage and some race-based discrimination as "badges and incidents of slavery". The Thirteenth Amendment has also been invoked to empower Congress to make laws against modern forms of slavery, such as sex trafficking.

Since 1804, states had divided into states that allowed or states that prohibited slavery. Slavery was implicitly recognized in the original Constitution in provisions such as Article I, Section 2, Clause 3, commonly known as the Three-Fifths Compromise, which provided that three-fifths of each state's enslaved population (“other persons”) was to be added to its free population for the purposes of apportioning seats in the United States House of Representatives and direct taxes among the states.

Though three million Confederate slaves were in fact freed by Lincoln's Emancipation Proclamation, their post-war status was uncertain. To ensure the abolition was beyond legal challenge, an amendment to the Constitution to that effect was initiated. On April 8, 1864, the Senate passed an amendment to abolish slavery. After one unsuccessful vote and extensive legislative maneuvering by the Lincoln administration, the House followed suit on January 31, 1865. The measure was swiftly ratified by nearly all Northern states, along with a sufficient number of border states (slave states not part of the Confederacy) up to the assassination of President Lincoln. However, the approval came via his successor, President Andrew Johnson, who encouraged the "reconstructed" Southern states of Alabama, North Carolina, and Georgia to agree, which brought the count to 27 states, leading to its adoption before the end of 1865.

Though the Amendment abolished slavery throughout the United States, some Black Americans, particularly in the South, were subjected to other forms of involuntary labor, such as under the Black Codes, as well as subjected to white supremacist violence, and selective enforcement of statutes, besides other disabilities.

Explanation:

What was one way in which the Spanish posed a threat to English colonial domination in North America?

Answers

Answer:

i dont knowwwwwwwwwwww

Explanation:

I don't know really maybe the south America  because they were self richest and dedicated to nothing -_-

what were the three cities that began as greek

Answers

Answer:

There grew to be over 1,000 city-states in ancient Greece, but the main poleis were Athína (Athens), Spárti (Sparta), Kórinthos (Corinth), Thíva (Thebes), Siracusa (Syracuse), Égina (Aegina), Ródos (Rhodes), Árgos, Erétria, and Elis.

Explanation:

c. Give reasons for the decline of Yuan Dynasty.

Answers

Answer:

Yuan dynasty was marked by struggle, famine, and bitterness among the populace.

Hope this helped!

In general, there were two major factors that contributed to the Yuan Dynasty's demise: one was class conflict caused by heavy taxation, and the other was ethnic conflict caused by the 'Four Class System.'Also, power struggles within the ruling class became more and more serious. The final years of the Yuan dynasty were marked by struggle, famine, and bitterness among the populace.

Which two events caused this culture found in Latin America?

A. Columbian Exchange and Mexican Revolution


B. Cuban Revolution and Brazilian Uprising


C. Columbian Exchange and Triangular Trade


D. Cuban Revolution and the Age Exploration

Answers

Answer:

History of Latin America, history of the region from the pre-Columbian period and including colonization by the Spanish and Portuguese beginning in the 15th century, the 19th-century wars of independence, and developments to the end of the 20th century.

Explanation:

Latin America is generally understood to consist of the entire continent of South America in addition to Mexico, Central America, and the islands of the Caribbean whose inhabitants speak a Romance language. The peoples of this large area shared the experience of conquest and colonization by the Spaniards and Portuguese from the late 15th through the 18th century as well as movements of independence from Spain and Portugal in the early 19th century. Even since independence, many of the various nations have experienced similar trends, and they have some awareness of a common heritage. However, there are also enormous differences between them. Not only do the people live in a large number of independent units, but the geography and climate of their countries vary immensely. The inhabitants’ social and cultural characteristics differ according to the constitution of the occupants before the Iberian conquest, the timing and nature of European occupation, and their varying material endowments and economic roles.

Please mark me as Brilliant

Select the correct answer.
How did Theseus manage to get out of the maze after killing the monster Minotaur?
A.
by using the sword of the king
B.
by using a ball of string
C.
by using the shield from Athens
D.
by using a magic wand

Answers

The answer is B using a ball of string

Answer: for Plato users.

B. By using a ball of string .

Explanation:

How was food preserved for the trip? a. Food was always fresh found or caught fresh each day. b. Food was preserved by freeze drying large amounts each month. c. Food was bought along the way, so it did not need to be preserved. d. Food was preserved through drying, canning, or curing. Please select the best answer from the choices provided A B C D

Answers

Answer:

D

Explanation:

Do you think court interpretations should change over time ?

Answers

Answer:

Yes, and here's my take...

Explanation:

According to the pragmatist view, the Constitution should be seen as evolving over time as a matter of social necessity. Looking solely to original meaning, when the original intent was largely to permit many practices universally condemned today, is under this view cause to reject pure originalism out of hand.

pls hurry!! 50 points! What are some ways average citizens can affect the environmental issue explored in the video? Check all that apply.

by moving away from coastal areas
by stopping fishing in the state’s wetlands
by conducting studies on the loss of wetlands
by forming interest groups to educate the public
by writing to politicians about changing the laws
by voting for officials who will address the issue

Answers

Answer:by conducting studies on the loss of wetlands

because they already studied the algortisthm at the is time to they didnt actualy have to,so ya

hope it helped

Answer:

d,e, and f :)

Explanation:

3) How did the French Revolution differ from those that occurred in Latin America?
How was it similar?

Answers

Answer:   While the French Revolution produced changes within the borders of France, the Latin American Wars of Independence established independent countries throughout large portions of South America, including Venezuela, Brazil, Argentina, Peru and Chile.

Explanation:

Answer: In the revolutions of America, France, and Latin America there was a common thread that united these revolutions as well as some differences in why. The common theme in the revolutions in America, France, and Latin America was independence from foreign rule. In the American Colonies, the colonists rebelled and fought for their independence from Great Britain. In France, the people rose up against the monarchy, and in Latin America the people sought independence from Spanish/Portuguese colonial control.

American Revolution

The America Colonies declared their independence on July 4th, 1776, with the adoption of the The unanimous Declaration of the thirteen United States of America by the Continental Congress. It asserted, “That all men are created equal, that they are endowed by their creator with certain unalienable rights, that among these are life, liberty and the pursuit of happiness”. Declaring war was a last resort. The colonist wanted to be treated the same as any another citizen of the king’s empire and this included having a representative in Parliament because they were paying taxes to England, who had increased taxes to pay the debt incurred by the Seven Year War (Bentley, 2006 p.784), but had no representation in England. These pleas fell on the deaf ears of the king and his Privy Council and which lead to the revolt in the American Colonies (Trail, Images of the American Revolution). In 1787 the Constitution Convention laid out the plans for a new system of government which granted rights to male property owners but left out native Americans, landless men, slaves, and women (Bentley, 2006 p.785-786).

Explanation:

5. Andrew Jackson served____
He is the countrys____president
terms as President of the United States.
.

Answers

Answer:

What are the options?

Explanation:

Andrew Jackson served from 1829 to 1837.
he is the country’s 7th president

how did new inventions such as washing machines benefit women?

Answers

The washing machine enabled women to join the workforce, allowing them to leave behind many of their household duties.

Answer:

Less work and more free time (AP3X)

Explanation:

Why might a person's first amendment rights be limited?

Answers

Answer:

depends on the right requested

Explanation:

__________ is a matter that is addressed in regards to the relationship between the nation and other nations.
A.
A domestic issue
B.
A foreign issue
C.
Limited government
D.
Anarchy

WILL GIVE BRANLIEST

Answers

Answer: B. A foreign issue
The answer is B. A foreign issue.

Which of the following individuals influenced Hitler's worldview?
A. scientist Albert Einstein
B. Vienna Mayor Karl Lueger
C. Winston Churchill
D. Paul von Hindenburg

Answer: B. Vienna Mayor Karl Lueger

Answers

Answer:

Benito Mussolini

This is the correct answer but there is no

what was the continuous front​

Answers

Answer:

The opposing armies in the west were so vast that they could be deployed across the entire European continent, forming a continuous front. Early in the war, the opposing armies engaged in mobile tactics in an effort to outflank each other, but were countered as opposing troops were brought in to extend their lines.

Before 1870, the European presence in Africa was characterized primarily by Group of answer choices military conquests of large territories administered as military states intense colonization and settlement of large areas active international interaction through trade and diplomacy coastal enclaves for trade and a few settlements

Answers

Answer:

Coastal enclaves for trade and a few settlements

Explanation:

Before 1870, the European presence in Africa was characterized primarily by "Coastal enclaves for trade and a few settlements."

This is evident in the fact that before the 1870s, most Europeans are only in Africa for the transatlantic slave trade. Thereby, they mostly settle near the ocean where they can easily and quickly transport the people they bought into slavery to the European and American continent.

4. Who crafted the Compromise of 1850?
a Abraham Lincoln
b. Daniel Webster
C. Henry Clay
d. Stephen A. Douglas

Answers

the answer would be C. Henry Clay

Answer:

C

Explanation:

To seek a compromise and advert a crises between North and south.

When did Hawaii become the 50th state?

1795
1900
1893
1959

Answers

Answer:

1959

Explanation:

Answer:

August 21, 1959

Explanation:

In 1790, which city had the lowest population density?
A.New York City
B. Boston
C. Savannah

Answers

the answer to your question is Boston , B.
The answer is going to be Boston

Picture of a tourist location in tennessee and what toursist.

Answers

Answer:

Its a remake of the Athena Parthenon in Greece.  

The Parthenon in Centennial Park, in Nashville, Tennessee, is a full-scale replica of the original Parthenon in Athens. It was designed by architect William Crawford Smith and built in 1897 as part of the Tennessee Centennial Exposition.

Explanation:

Why did the United States see nationalist movements as being related to communism?

Answers

Answer:

hi

Explanation:

Contemporary European History covers the history of Eastern and Western Europe, including the United Kingdom, from 1918 to the present. By combining a wide geographical compass with a relatively short time span, the journal achieves both range and depth in its coverage. It is open to all forms of historical inquiry – including cultural, economic, international, political and social approaches – and welcomes comparative analysis. One issue per year explores a broad theme under the guidance of a guest editor. The journal regularly features contributions from scholars outside the Anglophone community and acts as a channel of communication between European historians throughout the continent and beyond it.

What is his name and his job I don’t know him

Answers

is that johnny sins

Passage: The black Hand
The Black Hand Society found its membership in Austro-Hungary.
A. False B. True

2. What was the purpose of the Black Hand Society?
A. They wanted to take over Austria-Hungary.
B. They wanted to defeat Germany.
C. They wanted to unite the Serbs in an independent country.
D. They wanted to win World War I.

3. How did the Black Hand Society plan to reach their goal?
A. They got themselves elected into office.
B. They asked for a mediator.
C. They planned peace talks.
D. They planned terrorist attacks.

Answers

Answer:

1.false

2.They wanted to unite the Serbs in an independent country.

3.They asked for a mediator. I think

In the early days, information on public matters was usually scarce; information was handed off by
word of mouth & controlled by those in power. True or false

Answers

Answer:

True

Explanation:

Sorry if that's not the right answer

I just doing some research, but i couldn't find it

Which of the following would best support Schama’s argument in the first paragraph about the role of Churchill’s speeches in Great Britain’s war effort?

Answers

nononononononononononononononononononononononononononononononononononononononononononononononononononononononononononono

Answer: Despite its economic and logistical support for Britain, the United States did not formally join the war against Germany until after the Japanese attack on Pearl Harbor.

Explanation:

Other Questions
Read this excerpt from "The Spirit of Alcatraz.But activists say their most important accomplishment was changing the way American Indians looked at themselves. As activist John Trudell puts it, "Alcatraz put me back into my community and helped me remember who I am. It was a rekindling of the spirit.Each year, American Indians from different tribes pay tribute to that spirit by returning to the island on Columbus Day and Thanksgiving to remember the occupation with a Sunrise Ceremony for Indigenous Peoples.How does the quotation from John Trudell help readers better understand the story?The quotation helps readers relate to a Native Americans viewpoint.The quotation provides humor, which makes the story more interesting.The quotation persuades readers to beware of the dangers at Alcatraz.The quotation informs with facts and figures about the history of the island. At a school, 40% of the sixth-grade students said that hip-hop is their favorite kind of music. Only 5% liked Baby Shark the best. 100 sixth-grade students prefer hip hop music. How many 6th grade students are there at the school? Identify the percent of change as an increase or a decrease: 1/3 to 2/3 Balanced or Unbalanced? Write a B for Balanced and a U for Unbalanced. ______ 11.CH4 + O2 CO2 + 2 H2O ______ 12. NaBr + CaF2 NaF + CaBr2 ______ 13. 4 Fe + 3 O2 2 Fe2 O3 PLEASE HELP ME! 50 POINTS! I WILL GIVE BRAINLIEST! Decide whether the table could represent a proportional relationship. If the relationship could be proportional, what would be the constant of proportionality?Bettie's Boutique is having a 20% off sale.|original price| sale price||$15. | $12. ||$25. |$20. ||$35. |$28. |- Solve the inequality 18 Hayley loves to shop for make up. She went to her favorite store and bought eye shadow for $5.99, 2 bottles of nailpolish for $7.50 each and a tube of mascara for $8.50. She had a 20% discount coupon. Create and solve an equation to determine how much was her purchase after the discount was applied. A bag contains 3 red, 5 yellow, and 7 purple marbles. Find the probability of drawing a purple marble followed by a red marble. The first marble is put back in the bag between draws. PLEASE HELP IM CONFUSED. Is this relation a function? Justify your answer.A. Yes, because every x-value corresponds with a single y-value. B. Yes, because every x- and y-value is positive.C. Yes, because the number of x values is the same as the number of y-values.D. No, because two points with the same y-value have different x-values. What is the order starting with where humans live what shape can be formed from the following net? Write three points about why driverless cars are a bad idea. Why do states spend more money on education than any parts of the government? *anyone can comment, this is just an opinion on why you think they spend more on education.. I need ideas for a project* Please answer!!! Ill make brainliest Find the exact value of x.Thank you Find the volume of the triangular prism in the picture shown. Round your answer to thenearest tenth. *1: 1672:77.3 yd3: 77 yd What three dimensional shape is made when you rotate a triangle horizontally? Read and choose the correct verb in the preterite tense to complete the sentence.Nosotras ________ un buen viaje. tuve tuvo tuvimos tuviste In Act 3, Scene 1, Tybalt confronts Romeo and challenges him to a duel. What is the dramatic irony of this scene that motivates Romeo to forgive the insult by Tybalt? transcribe this strand of DNA 5' 3 TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-