How did the Crusaders change the balance of power in Europe?
The population of towns fell.
Trade was interrupted.
Persecution of Jews grew worse
Kings lost power.

Answers

Answer 1
Trade was interrupted
Answer 2
Trade was interrupted

Related Questions

GIVE BRANLIEST Which statement describes a success and a failure of Reconstruction?

A. The Freedmen's Bureau was formed, but Congress refused to fund it.


B. African Americans won the right to work, but most were only able to find work as sharecroppers.


C. Racial violence was eliminated, but African American freedoms were taken away.


D. A sharecropping system was set up, but Southerners refused to participate.

Answers

Im pretty sure its b because african americans win the rights to be able to find the wrights as sharecroppers
It’s b I think it’s right anyway

He's never gonna give you up. He's never gonna let you down. He's never gonna run around and desert you. He's never gonna make you cry. He's never gonna say goodbye. He's never gonna tell a lie and hurt you.

Answers

never gonna let you up never gonna bring you down
He knows the rules and so do I

PLZ HELP WILL GIVE BRAINLIEST

What does the 2nd map reveal about the extensive area in the Islamic empire by 750 CE?

Map pdf: http://cmartinresgmsd.weebly.com/uploads/3/8/3/1/38314033/muslim_trade_routes_powerpoint.pdf

Answers

Answer:

This reveals that the empire grew and expanded over the time of the caliphates.

Explanation:

This is evident as the shaded in territories represent what they conquered.

what happen was the empire was expanding and made them stronger

what did the Agricultural Adjustment act do?
it paid farmers and more wheat corn and cotton
it authorized government to purchase all the cotton farmed in Texas
it paid Farmers to refrain from Clanton certain crops to avoid another over supply of those crops
it authorized the government to spend money on pruvit providing electricity to rural areas

Answers

Answer:  it paid farmers and more wheat corn and cotton

Explanation:

The actual answer choices are:

A) It paid farmers to plant more wheat, corn, and cotton

B) it authorized the government to purchase all the cotton farmed in Texas.

C) It paid farmers to refrain from planting certain crops to avoid another oversupply of those crops.

D) It authorized the government to spend money on providing electricity to rural areas.

Note; This is for the person who said that the asker " Screwed up their answers"

Answer: C) It paid farmers to refrain from planting certain crops to avoid another oversupply of those crops.( don't listen to other person)

Explanation: I listend to other person and scored an 80% because his answer was wrong.

-Rayne<3

Can someone help me with this?

Answers

Supporting the reconstruction

Drag each tile to the correct location on the diagram.
Determine whether the following descriptions belong to Montesquieu, Locke, or both.

Answers

I believe this is the answer

Montesquieu:
Developed the political idea of separation of powers.

Locke:
Developed the theory of social contracts/Explored the concept of natural rights

Both:
Contributed to the Enlightenment thought

Why was it important for the Aztecs to form alliances with other groups in the Valley of Mexico?

Answers

Answer:

I might be talking off point. But em..

Explanation:

One of the ways in which the Aztec expanded in strength and wealth at the time was by acting as mercenaries and warriors for other societies in the region.  For example, in the decades after the founding of Tenochtitlan they worked as warriors for the Tepanec people.  The Tepanec used the Aztec to help with their battles and campaigns in the region against other rival societies.  For their help the Aztec received portions of the wealth that the Tepanec gathered from the societies that they defeated.  As a result, the city of Tenochtitlan grew in importance and wealth throughout the 14th and 15th centuries.  In general though, the Aztec were subjects of the more powerful Tepanec and Aztec leaders were only allowed to remain in power by paying tribute to the Tepanec.  Also, during this time period, Aztec rulers increased the power of their society by forming strong alliances with other societies around Lake Texcoco.  However, the relationship between the Aztecs and the Tepanec soon became strained and a conflict emerged. Itzcoatl became the leader of the Aztec in 1427 and became the fourth tlatoani of the Aztec people.  He reigned over the Aztec Empire from 1427 until 1440, and is best remembered as the leader who saw the Aztecs become the most powerful Mesoamerican society in the Valley of Mexico.  For example, as leader he famously formed an alliance with two other societies in the area in order to overthrow their mutual rivals.  The Aztecs, Texcoco and Tlacopan joined forces in 1428 to create the Triple Alliance.  Together they fought against the Tepanec and challenged them for superiority in the Valley of Mexico.  Over time the three were able to overpower all other societies in the Valley of Mexico.  As well, the Aztec became the strongest of the Triple Alliance and Tenochtitlan became the center of power in the region.  As such, the Triple Alliance was not always equal between the three city-states and heavily benefitted the Aztec.  Regardless, the formation of the Triple Alliance allowed the Aztec to expand their empire and eventually take control over large sections of the Mesoamerican region.

  AND..

Texcoco, Tenochtitlan and Tlacopán of the Triple Alliance. (Osuna Codex)

All of the Aztec rulers at this time pushed forward with expanding the Aztec Empire across Mexico and strengthening the power of Tenochtitlan.  In fact, the city grew in size and importance during this time as the Aztec culture came to dominate the region.  For example, by the early 16th century, Tenochtitlan is estimated to have been three to five square miles (eight to thirteen square kilometers), and have a population of between 200,000 and 300,000 people.  This means that it was one of the largest cities in the world at the time and larger than any in Europe.  As well, the Aztec Empire had spread far from the Valley of Mexico during this time and, at its height, the empire consisted of land across most of central Mexico including the coastlines in both the Gulf of Mexico and Pacific Ocean.  This vast expansion meant that the Aztec had conquered and suppressed many different groups of Mesoamerican peoples.  The Aztec controlled these different societies by forcing them to provide tributes for payment and ritual sacrifice.  Although the Triple Alliance made this expansion possible it also created a large number of enemies for the Aztec.  This is important because many of these enemy altepetl would join the Spanish in their assault on the Aztec capital of Tenochtitlan.

Sorry, If that's a lot this took me 2 hours to write. Hope all that helps..

- Lizzie

Why did the military consider Louisiana an ideal location to hold war maneuvers? Check all that apply.

-Louisiana’s large areas of open, rural land were ideal for training.
-Louisiana’s lack of ocean access meant more isolated grounds for secret tests.
-Louisiana’s varied landscape was ideal for testing out new tank technology.
-Louisiana’s atom bomb research facilities meant military bases were already in place.
-Louisiana’s leadership in manufacturing made it easy for war supplies to get to the area.

Answers

Answer:Sparsely populated, thick with undergrowth and uncharted swamps, and scarred by rural traces that turn to muck at the slightest hint of rain, central Louisiana was an ideal place to prepare an army, with vast tracts of land that could accommodate the large-scale maneuvers the Army needed to conduct.

Explanation:

Please help me 2 okay

Answers

Answer:

the second one is right

Explanation:

The 2 one is right
STEP EXPLAIN

The lack of unity among Greek city-states made Greece easier to conquer. Truth of False

Answers

The Answer is true!!!

Answer: true is the right answer for this

Explanation:

Hi, I need help with this question.

Answers

I think A but i’m not 100% sure
Yes it’s a give them person above me credit

How do you think that Helen Keller was able to overcome her obstacles? Please describe an obstacle you’ve overcome.

Answers

Answer: I think Helen Keller got over her obstacles because there was someone that believed in her and there was someone to put pressure on her and that pressure helped her work harder for what she wanted. Which was to talk and see again.

Explanation:

I had a spelling bee and I was the only one from my school and I was anxious and scared to death that I was going to fail. But, I practiced and made sure that I did good and I reached my goal.

(I hope this helps you.)

Answer:

I believe that Helen Keller was able to overcome her obstacles by not giving up and by her teacher Ms. Sullivan teaching her to communicate using the manual alphabet since she was blind and deaf. Although she was she let nothing get in the way of her education.

(Your obstacle you overcame) or you can use mine which is:

An obstacle I overcame was facing the unknown. Its come to me that I had become comfortable with what I am familiar and wanted to stay in that zone but there were many new things that I was too scared to try and were way out of my comfort zone because I did not know what could happen. That obstacle stopped me from many great opportunities and I came to the point in my life where I decided I was going to overcome it and was not going to give anymore excuses because that was all I was doing. Although it was not easy I stepped out of my comfort zone and took the opportunities given to me which was for the better and now I'm in a great place. Of course it was not easy but it will will be that's why they are called obstacles but you should not just give up because that's when you need to try your hardest.

Explanation:

Why are the authors discussed in lesson 4.03 important to American History?


A. They were the first group of authors that were born and raised in America, writing about issues and themes in America.


B. They all became American politicians later in life.


C. They traveled the world and taught others about America.


D. They helped fight later in the Civil War.

Answers

A is the correct answer

The authors discussed in lesson 4.03 the importance to American History because They were the first group of authors that were born and raised in America, writing about issues and themes in America. Thus the correct option is A.

What is American History?

There have been more than 400 years of literary evolution in America. Beginning in the 1600s, the earliest European settlers in North America started to record their adventures in writing. The declaration of American independence in 1776 marked the beginning of a new era.

In North America, it has a reputation earliest known in American history. The authors of lecture, 4.03 are important to American history because they wrote them after the American War had been concluded.

4.03 are important to American History because they were the first group of founders to be born and raised in the country and because they read about American issues and themes in order to give brief summary.

Therefore, option A is appropriate.

Learn more about American History, here:

https://brainly.com/question/22081876

#SPJ2

The framers of the Texas Constitution showed the strongest commitment to popular sovereignty in-

Answers

Answer: B

Explanation:

The framers of the Constitution created the United States Senate to protect the rights of individual states and safeguard minority opinion in a system of government designed to give greater power to the national government.

Humans have always developed new inventions and ways of doing things. Sometimes, innovations have led to a transformation of hum society. Organize the innovations below by the societal system they helped create. Agrarian Society domestication of animals Complex Civilization X development of metal X armor planting of seeds creation of a bureaucracy​

Answers

Answer:

for the one on the left flip the bottom 2

for the one on the right i think its supposed to be flipped

Explanation:

agrarian-

domestication

development

planting

complex-

create laws and rules

bureacracy

metal

for complex i think that the metal could possibly go first aswell not sure tho.

I need more help ;-; IYHAGSFHDJK

Of the following, which is NOT a reason Ulysses attacks the city in “The Ciconians?”

A. The villagers are hostile.
B. Ten years of war has made them savage.
C. They are greedy
D. It will be bad luck not to attack.

Answers

C is the correct answer
The answer is C I believe !

Why the United States shouldn't have become an imperialist nation?

Answers

Answer:

Imperialism impacted societies in countless negative ways. It led to slave trade which then led to social discrimination around the world. It also damaged the cultures and created disunity among the natives. Last but not least, imperialism stripped countries off their natural resources and left nothing for the natives.

Explanation:

Please help! Will give Brainliest!
View the art shown on the British Art of the First World War, The National WWI Museum and Memorial websites. Select two pieces of art, copy and paste them below, then in your own words write a paragraph response for each. Include the following information:

* What is the picture depicting?

* Which side does it favor?

* How accurate is it and how would it affect the public’s view of the war?

Each response should have a minimum of 5 sentences and include the picture.

Answers

Answer:Liberty Memorial was designed in the early 1920s by H. Van Buren Magonigle. From 1995-2006, Abend Singleton Associates restored the original Memorial to meet national standards for accessibility and security and designed the state-of-the art Museum space and supporting facilities underneath the Liberty Memorial. Ralph Appelbaum Associates designed the innovative and engaging exhibitions in the new gallery space. Learn about the many architectural and symbolic elements that make the Liberty Memorial one of Kansas City’s iconic landmarks.The Liberty Memorial Tower rises 217 feet above the main courtyard and 268 feet above the North Lawn. The cylindrical tower is 36 feet in diameter at its base, tapering to 28 feet at the top.  Guests can take an elevator followed by 45 stairs to the open-air observation deck for a breathtaking view of the Kansas City skyline. At night, a Flame of Inspiration, created by steam and lighting effects, is emitted from the top of the tower and can be seen from miles away. The monument received designation as a National Historic Landmark in 2006 and recognition from Congress as a national memorial in 2014.

Explanation:

How does Philadelphia represent the changes cities underwent?

Answers

Answer from the global crisis, alsoooo flooding is going to be  thir new reality,  building codes must reflect that.

Explanation:


Explain the quote "American blood shed on American soil.”

Answers

Answer:

Douglas thought that since the climate in Kansas and Nebraska is awful for cotton plantations, he thought that the non slave states would be okay with it being passed

Explanation:

answer for points!!

Answers

Alright, I answered. Glad I could help!!!
it said to reply for points ?

Only 1% of people can highlight copy then paste it in anyone comments
‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎
‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎ ‎‎

Answers

Answer:

Okay?

Explanation:

During reconstruction abraham lincoln planned to use federal resources to:

Correct?

Answers

Yes it should be I think
Yes it should be correct!

What is an effective counterclaim for an argumentative essay on Louisiana’s economy?

It is not the case that Louisiana’s economy is stronger than it has ever been because it still faces major issues, such as unemployment.
It is true that Louisiana’s economy is the strongest that it has been in years because industry is growing and thriving across the state.
Some may incorrectly argue the state’s economy is not strong because that’s just how negative people tend to think.
It is too difficult to tell what condition the economy is actually in because there are not enough economic indicators.

Answers

Answer:

its b

Explanation:

Answer:

its B Louisana state budget has been reduced by about 9 billion dollars , which is must smaller than it has been in years.

Explanation:

edge 2021

free youngboy bitcxx

Read the passage below and answer the question.
In the 1930s, the Australian archaeologist V. Gordon Childe proposed that this suite of changes be called the “Neolithic Revolution.” Archaeologists first used the term Neolithic (or New Stone Age) to describe distinctive polished stone tools that appear from about 10,000 years ago. But Childe insisted that the real significance of this period lay in something more revolutionary: the emergence of agriculture. Agriculture laid the foundations for all the most important developments of later human history. Today, many prehistorians resist Childe’s term because they know that when examined closely, the changes turn out to have been gradual. Contemporaries could hardly have known they were living through a revolution. Nevertheless, Childe’s notion of a Neolithic or agrarian revolution deserves to survive, for on the scale of human history as a whole, the changes were both rapid and revolutionary. During a mere 7,500 years, between 11,500 and 4,000 years ago, agricultural communities with domesticated plants and animals appeared in at least three quite separate regions of the world, and perhaps as many as seven.
Excerpt From: David Christian, Maps of Time: An Introduction to Big History (2011), 489.
Which of the following arguments regarding the relationship between polished stone tools and the emergence of agriculture is most defensible?
Choose 1 answer:



A: The emergence of agriculture caused the emergence of polished stone tools


B: The emergence of polished stone tools caused the emergence of agriculture

(Choice C)
The emergence of polished stone tools was unrelated to the emergence of agriculture

(Choice D)
The emergence of polished stone tools and agriculture were probably related, but whether one caused the other is unclear


PLZ HELP
PLZ HELP

Answers

B. The emergence of polished stone tools caused the emergence of agriculture

Answer:

b

Explanation:

Where did the Renaissance begin?


Milan


Florence


Rome


Venice

Answers

Answer:

The Renaissance began in Florence, Italy.

Explanation:

The Renaissance began in Florence, Italy, where many artists could be supported by wealthy people. (The Medici family ruled Florence and contributed a lot to this movement.)

Answer: Florence

Explanation:

What resulted from the corruption investigations in Louisiana in the late 1930s?

Earl Long was elected governor of Louisiana in 1940 in a landslide victory.

The federal government took direct control of Louisiana’s executive branch.

The 1940 elections removed the Longites from the Louisiana state legislature.

Louisiana voters elected Sam Jones, an Anti-Longite, as governor in 1940.

Answers

Answer:

Explanation:

When the Louisiana voters in 1930 elected Huey Long to the United States Senate, the thirty-seven-year-old dynamo already exercised a tight grip over state politics, built up during his years as governor. Unwilling to relinquish the reins of state power to an unfriendly lieutenant governor, Long delayed claiming his Senate seat until January 1932. The next summer, he employed his charismatic eloquence on behalf of both presidential candidate Franklin D. Roosevelt and his personal choice for the second Louisiana Senate seat, U. S. Representative John H. Overton. Long's strength in Louisiana had no equal, and in the September 13, 1932, primary, John Overton easily defeated incumbent Senator Edwin Broussard for the Democratic nomination, a prelude to an unopposed victory in the general election.

How did the following factors increase American production?

War, communication improvements, transportation improvements, and mass production

Answers

Answer:

war

Explanation:

they needed guns and supplies for the soldiers  

communication...: people could ask for a certain product  

transportation...: get supplies easier for making stuff  

mass...: they could make large quantities of stuff faster

They required guns and supplies for the soldiers because of the war, people may request a specific product through communication, transportation could access supplies for producing things more easily, and mass production could produce enormous amounts of goods more quickly.

How do the factors increase American production?

War: Gunsmiths made it easier for soldiers to obtain the weapons and equipment they needed to fight.

Communication advancements: The telephone enabled individuals to ask for a specific person and speak with them practically quickly.

Transportation advancements: Cars and boats allowed humans to access supplies for producing things more quickly.

Mass production: Factories made it possible to produce enormous quantities of goods in a short period of time.

For more information about American production, refer below

https://brainly.com/question/8008691

What is the Sahel?


an African territory that is of historical importance


a landform found only in Africa, it is a cross between a mountain and a plateau


a climatic event with high winds and heavy rains


a wide area of dry land located along the southern edge of the Sahara

help quick!!!

Answers

I belive that the answer is D. because a Sahel is not A. "an African territory of historical importance". It is not B. "a landform found only in Africa, it is a cross between a mountain and a plateau" It is not C. "a climatic event with high winds and heavy rains". But it is correct that it is "a wide area of dry land located along the southern edge of the Sahara". which makes it D.

When the Romans had their revolt they established _________________. *
A kingdom
The Empire
the Republic
Pax Romana

Answers

The answer is the empire. Good luck
The answer is The republic ;)
Other Questions
In Act 3, Scene 1, Tybalt confronts Romeo and challenges him to a duel. What is the dramatic irony of this scene that motivates Romeo to forgive the insult by Tybalt? transcribe this strand of DNA 5' 3 TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid- Answer this PLZZZZZZ The Roman god Neptune and the Greek god Poseidon BOTH were considered to be the god ofA)war.B)time.C)the sea.D)the underworld A smoothie shop has 40 stores and 55% of the stores are in California. The rest of the stores are in Nevada. How many stores are in California? 22184595 Identify and explain three factors that contributed to the origin of the Cold War The ____________________ is the reproductive structure of gymnosperms. find the size of angle X. hi please help with my maths! a partir del texto,resuelvan las siguientes preguntas:A)En que ao se lanzaron las sondas voyager 1 y voyager 2 I NEED AN ANSWER ASAP. A brief summary of the career and contributions of James Galway and his flutist career what are the two elements found in silicon dioxide URGENT !!!!!!!!! Please answer correctly !!!!! Will be marking Brianliest !!!!!!!!!!!!!!!! URGENT !!!!!!!!! Please answer correctly !!!!! Will be marking Brianliest !!!!!!!!!!!!!!! y= 4/3x -8 4x-3y=24 A larger car takes more force to move._O Newton's 1st lawO Newton's 2nd lawO newton's 3rd lawO newton's 4th law Help on this question pleaseeeeeeee If the DNA sequence of bases is GGA-AAC, what is the mRNA sequence, what is a example of acceleration? vitamin(a) retinol function on the body