amino acidsOkay, we can mention that the energy transformation occurring in plants at photosynthesis is basically the keystone of all of the trophic networks or food chain since these organisms can make their own resources on the stroma and thylakoids of their chloroplasts, like starch made up of glucose (capturing CO2, and producing also O2 as a subproduct), from the sunlight, reason they're known as autotrophs.
This will be used by animals, which will eat the plants to get food in form of leaves or fruits, getting energy for their cellular processes, like the production of ATP molecules for cellular respiration. This process consists of the catabolization of greater molecules to smaller ones taken mainly from carbohydrates, but also from aminoacids or lipids.
2. Sickle Cell Anemia is inherited as an autosomal recessive trait. What would be
the chances of a non-carrier female and a man with sickle cell anemia having
afflicted children?
a) Assign Symbols
b) Show the cross
c) Punnett square
d) Genotypic ratio
e) Phenotypic Ratio
The chances of a non-carrier female and a man with sickle cell anemia having afflicted children would be 25%.
What is anemia?
When you have anaemia, your body does not create enough healthy red blood cells to supply your tissues with just enough oxygen. Being anaemic, or having low haemoglobin levels, can make you feel tired and fragile. Anemia can manifest itself in a variety of ways, each with its own set of causes. Anemia can be minor to severe, and it can be short-term or long-term. Anemia is often caused by a combination of factors. Consult a doctor if you suspect you have anaemia. It could be an indication of a serious sickness. Treatments for anaemia can range from taking vitamins to seeking medical help, depending on the underlying cause. A balanced, diverse diet may help you avoid some types of anaemia.
To learn more about anemia
https://brainly.com/question/8197071
#SPJ1
May I get help with number two and with a punnets square
The hemophilia gene is an X-linked recessive gene. This means that a person will be hemophiliac if has two copies of the recessive "h" allele (in the case of females) or if has one copy (in the case of males). This also means that if the individual possesses the dominant H allele, he or she will not have hemophilia. Therefore, when performing the punnet table of section 2, we can observe that only one of four descendants would present hemophilia and in this case, it would be a male with genotype X^h Y (25% male), and only one of four would be a carrier that doesn't present hemophilia and in this case, it would be a woman with genotype X^H X^h (25% female)
Which example best describes a computer model that could be used to better
understand the function of the brain?
A. A simulation predicting the paths of electrical impulses through
the brain
B. A detailed re-creation of the brain in modeling clay that shows the
positions of its structures
C. A description of the brain as a computer processor that interprets
encoded information
D. A formula for calculating the time it takes a message from the
brain to reach a different part of the body
Answer: Which example best describes a computer model that could be used to better understand the function of the brain?
A. A simulation predicting the paths of electrical impulses through the brain is the best example of a computer model that could be used to better understand the function of the brain.
Explanation:
In this simulation, a computer program would be used to create a virtual representation of the brain and simulate the movement of electrical impulses along different pathways. This can help researchers and scientists study how the brain processes information and how different areas of the brain communicate with each other.
By using this computer model, scientists can observe the patterns and pathways of electrical activity in the brain, which can provide valuable insights into how the brain functions. This can help in understanding various neurological disorders and developing treatments for them.
What kingdoms of life can have either sexual or asexual reproduction?Plantae, archaea, fungiAnimalia, plantae, and fungiPlantae, protista, and fungiEubacteria, protista, and fungi
We have to consider that sexual and asexual reproduction differs in that the first one requires both organisms, one male and one female, to produce genetically different offspring, while the second one requires only one organism to produce genetically identical offspring.
About the kind of organisms mentioned in the answer options, we can say Protista includes Fungi, so the answer options that include both of them can be excluded, mainly due to choosing one of those options would exclude other organisms that can be in fact sexual or asexual.
Having this clear, we can say that organisms such as those belonging to the Plantae, Fungi, and Animalia kingdoms can reproduce in these two ways (unlike Archaea, and Eubacteria).
In the pictures below we can see examples of organisms of these species that can reproduce both asexually and sexually. In them, we can see ants (which can produce eggs with only the genetic load of one parental organism), plants (which can reproduce through branches, but also through seeds), and fungi (which can reproduce also mitotically and meiotically), as in the second answer option.
The digestive process involves two main types of digestion. Identify each one and explain how each works to break down food. Indicate where each type of digestion takes place in the body.
please help need to finish on Friday
The two types of digestion include the following below:
Mechanical digestion - This involves the use of physical methods and force to break down food such as in the mouth.Chemical digestion - This involves enzymatic action to break food down such as in the stomach.What is Digestion?This is referred to as the process in which food is broken down into smaller substances so as to be acted on by enzymes and assimilated into the bloodstream for the optimal functioning of the body.
Mechanical digestion happens in the mouth and it involves processes such as chewing while chemical digestion involves the breakdown of food through enzymatic actions.
Read more about Digestion here https://brainly.com/question/21470803
#SPJ1
In this process humans would select animals or plants with a trait they desire then breed those organisms to produce more individuals with the desired traits.Natural selectionContaminationInseminationArtificial selection.
The correct answer is Artificial selection.
Humans interfere in the natural process of organisms that they slect the desirable trait for the organisms that they think best will help the organisms to adapt well into their environment.
QUESTION 17Which of the following best describes the definition of a gene?A collection of polypeptides that fold to form a complex proteinGenetic information that produces a product, either proteins or RNAThe protein product that genetic material producesA section of DNA that produces a single protein product
As we know a gene is the minimal functional part of DNA and code for different traits, these can be proteins, RNA, or other type of regulators, so we can say that the correct option is the number 2
An organism is born with a genetic abnormality not present in any of its ancestors. This abnormality is most likely the result of?
Genetic diseases or abnormalities can be inherited or a result of a mutation, which is a change in the nucleotide sequence in the DNA of the organism.
Mutations can happen as a result of errors during mitosis or meiosis, as well as by damage from exposure to UV radiation or a chemical substance.
So, the right answer is mutation (option A)
Which of the following is NOT a consequence of using fossil fuels?A. Copper sulfate is released, contributing to destruction of the Ozone layer.B. Carbon dioxide is released, contributing to global warming.C. Sulfur dioxide is released, contribing to acid rain.D. Ash is released, contributing to solid waste in landfills.
Biology > Ecology > Air pollution
Burning fossil fuels such as gasoline or oil generates numerous pollutants, such as ashes, sulfur and carbon dioxides, which contaminate the environment, affect air quality and contribute to global warming.
One of the compounds not generated during this process is copper sulfates. Therefore, the answer is A.
has warm temperatures and is dominated by grasses
Answer:
Grasslands (?)
Explanation:
You didn't give much context, but grasslands have warm temperatures and are generally dominated by grass--
Tropical grasslands have dry and wet seasons that remain warm all the time.
Temperate grasslands have cold winters and warm summers with some rain.
The most likely answer is tropical grasslands because they are warm all the time. (grasslands is a more open answer)
The restriction enzyme EcoR1 recognizes the DNA sequence GAATTC. Which DNA strands will be cut by
EcoR1?
i. TTCAGGAATTCGGAAACC
AAGTCCTTAAGCCTTTGG
ii. TGAATCGAACCTG
ACTTAGCTTGGAC
iii. TTAAGCGGCCGAATTCAGTCCA
AATTCGCCCGCTTAAGTCAGGT
iv. CAGTAGGATTTCTGTGTC
GTCATCCTAAAGACACAG
EcoR1 creates 4 nucleotide sticky ends with 5' end overhangs of AATT.
These are the two options (i) and (iii) and the red marks indicate how the segment would be cut. So, the correct answer is option (iii)
Please give me brainliest
I need the answer to this question A.Or B.OrC.Or D
The endosymbiotic theory states that some organelles in eukaryotic cells are original from prokaryotic microbes (bacteria), being mitochondria and chloroplast the example of the theory. Therefore, for the students demonstrate the endosymbiotic theory with the biological material that was offered to them they have to show the big bacteria ingesting the small one.
In what situation would the allelefrequency of a population NOT change?A. when individuals move into or out of an environmentB. when there is no evolutionC. when mutations create new allelesD. when individuals choose their mates
Answer
B. when there is no evolution
Explanation
How does dehydrating or drying food help preserve it?A. It decreases the smell so other animals won't come steal itB. Removing the water hinders the ability for chemical reactions, which keeps microbes from growingC. The food becomes smaller and more easily stored.D. This increases the good bacteria to hinder the growth of bad bacteria
Water is needed for all life forms, including microorganisms, removing the water from food to preserve it means the microorganisms cannot perform the chemical reactions needed to consume the food, so the food is preserved for a longer time (option B is the right answer).
Which of the following choices is a form of asexual reproduction?OOOOfragmentation and regenerationoviparous eggsovoviviparous developmentviviparous development
Fragmentation and regeneration are forms of asexual reproduction.
There are no sexual cells involved, and they divide by mitosis, giving genetically identical individuals.
The motor division of the Peripheral NervousSystem is divided into the....A. right motor division and left motor divisionB. fight division and flight divisionC. upper motor division and lower motor divisionD. somatic nervous system and autonomic nervous system
The peripheral nervous system transmits information between the central nervous system and the rest of the body. It is divided into two: the Somatic Nervous system, which receives and relays stimulus to the central nervous system, and the Autonomic Nervous system, which regulates the involuntary activities of the body.
ANSWER: D. somatic nervous system and autonomic nervous system
Is the trait (blue) in the pedigree most likely caused by the presence of a dominant or recessive allele?Group of answer choicesrecessivedominantneitherboth
The blue trait is most likely caused by a dominant allele (e.g. allele A), while the white trait is caused by a recessive allele (allele a). However, for the diagram to be correct, individuals 1I and 2I must have genotypes Aa (blue) and aa (white) respectively, thus making the punnet squares, the genotypes of their offspring would be Aa (blue) and aa (white). In turn, we can verify that this is correct by observing the third generation since if the blue individuals of the second generation had genotype AA, they could not have white offspring (aa). If we make all the crosses, the genotypes would be as follows:
1 I: Aa 2 I: aa
1 II: Aa 2 II: aa 3 II: aa 4 II: aa 5 II: Aa 6 II: aa 7 II: Aa 8 II: Aa
1 III: Aa 2 III: aa 3 III: aa 4 III: aa 5 III: aa 6 III: Aa or AA 7 III: aa 8 III: Aa or AA 9 III: aa
what is a co factor ?give examples
Answer:
Cofactors are inorganic or small organic molecules that bind enzymes to enable or enhance their activity. Common inorganic cofactors are metals, including but not limited to magnesium, manganese, zinc, molybdenum, cobalt, and copper.
Explanation:
How many times more energy is produced by all three stages of cellular respiration than by glycolysis alone
The all three process of cellular respiration produces 18 times more ATP than glycolysis alone.
As there are 4 ATP produced in glycolysis from one molecule of glucose,2 from Krebs cycle, and rest 34 from electron transport chain.
These three process made total of 38 ATP
A scientist is studying the inheritance of two characteristics in plants: red flowers (RR and Rr) , which are dominant to yellow flowers (rr) , and green leaves (GG and Gg) , which are dominant to yellow leaves (gg).She crosses a double heterozygous (RrGg) with a double recessive (rrgg), and expect to see a 1:1:1:1 ratio in the offspring.Instead, she sees these results: Which phenomenon would she hypothesize accounts for the pattern she sees?crossing-overindependent assortmentcytokinesisrespiration
It wouldn't be respiration, because it has no direct relation to procreation. It wouldn't be independent assortment also, because this is the phenomenon that would explain the expected result. It also wouldn't be cytokinesis because this phenomenon is related to cell division, in which the combinations are already set. So, it is crossing-over, because this phenomenon occurs when ther is a switch between homologous chromatids occured during meiosis, which means that the chromosomes are so close to each other that they can trade parts of itselfs with other chromosomes, unexpectedly providing a different outcome than the one that was expected. So, the answer is crossing-over.
Signals from the sense organs are interpreted by the cerebrum, autonomic nervous system, medulla, cerebellum?
The correct answer is
Autonomic Nervous system
The nervous system is the command center of the organism's body. It interprets the messages it received from the sense organs. The brain is the control center of the nervous system. The cerebrum, medulla, and cerebellum are all parts of the brain.
Which dissolved substance do aquatic plants absorb from water during photosynthesis The choices are: carbon dioxide, ATP, oxygen, nitrogen
In the case of aquatic plants those that are totally submerged like seagrass, do photosynthesis as well as terrestrial plants, which need light carbon dioxide and expel oxygen. However, carbon dioxide in water dissolves so aquatic plants obtain it not in a gaseous way but in a dissolved way, so we can say that he correct answer is carbon dioxide.
What is the meaning of the term plankton? Name two types of plankton
EXPLANATION/ANSWER:
The term "plankton" comes from the Greek word "planktos" which means wandering. Planktons are microscopic organisms that are floating and being carried by tides and currents. There are two types of planktons: phytoplankton and zooplankton. Phytoplanktons are aquatic microorganisms that have chlorophyll and can make food from sunlight. Zooplanktons are aquatic microorganisms that consume phytoplanktons or other zooplanktons.
Is my response to this good is there anything I can change or add to make it better? You now know what an ecosystem is—and how varied ecosystems can be. Pick an ecosystem near you—find one that it as large or small as you wish. All areas—urban, suburban, and rural—have many ecosystems to choose from. Write a description of the ecosystem, including biotic and abiotic factors, in NO MORE THAN FOUR SENTENCES.An ecosystem close to me is a river. Abiotic factors: High water quality and the water is very clear. The average water temperature is 55F, and the water gets a lot of sunlight. Biotic factors: There are many different types of fish, such as bull trout and salmon. Many different kinds of frogs live in and along the edges of the river, and various kinds of plants and algae.
River ecosystem is also referred to as lotic ecosystem. Important descriptions of a river ecosystem includes the temperature, flow of water, floods, sediment transport, river bed features, and structure of habitat. It can also include the geographical area. Biotic factors can include the other plants and animals around the river including the land and aerial animals. Abiotic factors can also include substrate and composition aside from the temperature and light factors you already mentioned.
What blood types are possible for a child whose parents both have AB bloodtype?I. AII. BIll. ABIV. OA. Only IB. Ill and IVC. I and IlD. I, Il, and Ill
They are asking us the possible blood types for a child of parents with AB blood type.
This means that both parents have one allele for antigen A (Iᵃ) and one allele for antigen B (IᵃIᵇ):
Mother: IᵃIᵇ
Father: IᵃIᵇ
Just from that, the child cannot be type O, because there is no allele for not having any antigen (i).
Let's look at the Punnet's square:
As we can see, the child of this couple could have blood type A, B, or AB.
This means the right answer is D. I, Il, and Ill
Ultraviolet light can be used to kill bacteria in food.TRUEFALSE
The correct answer is TRUE,
bones will usually heal after they have been severely damaged so long as the cellular components of the endosteum and periosteum survive and there is a(n)
Answer:
ossification Center
Explanation:
Why do we use onion root tips and whitefish embryos to view mitosis?
Cells divide for three reasosn: growth, reproduction and repair.
Onion root tips and whitefish embryos presents cells that's always undergoing mitosis.
Onion root tips are always growing to get more water and nutrients from the soil, therefore mitosis is always occuring to duplicate the cells and maintain a growing rate.
Whitefish embryos have cells that are undergoing mitosis rapidly, as it is a phase of intense growing and formation of the embryos to become fish.
Would the absence of the nucleolus affect the process of protein synthesis? Explain
(HELP NEEDED BY THE NEXT FEW HOURS. THANK U SO MUCH)
The absence of nucleolus will affect the process of protein synthesis because r-RNA is required for protein formation and the synthesis of r-RNA occurs in the nucleolus.
Nucleolus is a small dense structure present inside the nucleus. It is site for r-RNA synthesis. Ribosome assembly also takes place inside the nucleolus. Nucleolus is also known to play part during cell's response to stress.
r-RNA is the ribosomal RNA. It is involved in the formation of ribosome along with some proteins. Ribosome is the most essential machinery for the synthesis of proteins. r-RNA belongs to the category of non-coding RNAs. r-RNA is considered to be a ribozyme.
To know more about r-RNA, here
brainly.com/question/13868647
#SPJ1
The diagram shows a cross between a plant with white flowers and a plant with red flowers.The offspring is a plant with pink flowers.Which pattern of inheritance is shown?
Answer: Incomplete Dominance
Explanation:
Incomplete dominance is described by a phenotype that is not completely dominant over another. Therefore, it will be a "blending" of colors in the case of this question, therefore the petals are pink.