Can someone plz help me!? I've asked a lot of ppl so now its time for brainly.
I have a petition I'm starting for the government with a fundraiser included. Does anybody know where I would send the funds to? For Indiana government?


Plz help!

Answers

Answer 1

Answer:

Attorney General: Charitable Fundraising - IN.gov

Explanation:


Related Questions

what is the meaning of presidency​

Answers

Answer:

A presidency is an administration or the executive, the collective administrative and governmental entity that exists around an office of president of a state or nation.

Example : the office of president

If the defendant fails to answer a complaint, the judge may decide to issue a _____.
a.
Civil settlement
b.
Default judgment
c.
Summary judgment
d.
None of the above

Answers

Answer:

b.

Default judgment

Explanation:

If the defendant fails to answer the plaintiff's claims or fails to appear at the hearing, the judge may, upon the plaintiff's request, hear and decide the case without hearing the defendant's side. This is called a default judgment.

Answer:

b. Default judgment

Name 1 CRIME SCENE factor that affects the validity of eyewitness testimony.

Answers

Answer:

The race of the witness/victim compared to the race of the aggressor is a significant factor in assessing the accuracy of eyewitness identification. Even biological factors, such as age, race, and gender.

Explanation:

Memory reconstruction. It is a common misconception that the human memory works like a video recording, allowing people to replay events in their minds just as they occurred. ..

Explain the difference between ethical issues and legal issues.

Answers

Ethical issues are based on what's wrong and right, whereas legal issues are based on the law.

Examples of Ethical Issues:

Toxic Workplace Culture

Unrealistic and Conflicting Goals

Discrimination

Harassment

Examples of Legal Issues:

Annexations

Personnel decisions (terminations and general compliance with County policies, as well as state and federal laws)

Court of Tax Appeals

And so on, I hope this gives you a better understanding of what the two are and what makes them different from each other.

True or false ? : Suspension is a positive form of punishment that Youth Court uses very
frequently

Answers

True I’m pretty sure

Can someone plz help me!? I've asked a lot of ppl so now its time for brainly.
I have a petition I'm starting for the government with a fundraiser included. Does anybody know where I would send the funds to? For Indiana government?


Plz help!


I NEEED THE ACTUAL PLACE PLZ

Answers

Answer:

If you look up on indianas gov website I think it will show!

Explanation:

im not sure tho

Why is it important to gather facts before you evaluate or judge something or someone?

Answers

Answer:

It is always important to collect facts, data and information so as not to fall into errors of judgment regarding other people or situations, which give a flawed look regarding those. Thus, it is always necessary to have the information that allows you to correctly evaluate and assess what is perceived, so that you can get the best experience and benefit from it.

How old is dusty dusty

Answers

Answer:

27 years old

Explanation:

Answer:

anyone can be crusty and dusty

Explanation:

Name 2 SUSPECT factors that affect the validity of eyewitness testimony.

Answers

Answer:

Lineup issues. ...

Visual characteristics

Explanation:

*lineup issues

Witnesses are often asked to identify suspects through lineups, both physical and photographs.

*visual characteristics

Often, witnesses base their identifications off a suspect’s defining features or characteristics.

what is the word for A _________ economy is a market-based system in which the government is involved to some extent.

Answers

Answer:

Market economy

Explanation:

Identify each of the following drugs.

Oxycodone

O Inhalant
O Stimulant
O Hallucinogen
O Depressant
O Narcotic

Answers

oxycodone is a narcotic

what is civilization?​

Answers

Answer: A civilization is a large community

Explanation:

A civilization is generally an advanced stage of organization. ... That means it has laws, culture, a regular way of getting food and protecting the people. Most civilizations have agriculture, and a system of government like monarchs or elections.

NEED HELP ASAP TYSMMMM

Answers

Answer:

The answer is units of local government

Explanation:

There are four main types of local government- counties, municipalities (cities and town), special districts, and school districts. Counties are the largest units of local government, numbering about 8,000 nationwide. They provide many of the same services provided by cities.

Look at this link for more info:

http://www.lessonsonlocalgovernment.org/multi-grade-lessons/lessons/download-asset/id/215/recid/46#:~:text=There%20are%20four%20main%20types,same%20services%20provided%20by%20cities.

It’s units of local government

please helpppppPpPPP

Answers

Answer:

its a i had this question like 5 days ago trust me

a is the correct answer

Probation is effective at preventing a return to crime when

A) higher fines are imposed
B) criminals are harshly punished
C) there are enough resources to provide probation services properly
D) criminals are religious

Answers

Answer:

a.) higher fines are imposed

Explanation:

Probation is effective at preventing a return to crime when higher fines are being imposed.

What do you mean by Probation?

Probation refers to the process of testing or observing the character or abilities of a person who is new to a role or any job.

Probation is effective at preventing a return to crime when higher fines are imposed.

Therefore, A is the correct option.

Learn more about probation here:

https://brainly.com/question/12711873

#SPJ2

Officer Jax was new on the job. He saw a man dressed all in black sneak in to an apartment through the front door. Jax followed him and busted
down the door. He grabbed the man in black and yelled, "Got ya', you crook!" The man lived there and was quietly entering the apartment, because
his wife, who was a nurse and had worked the night shift, was still asleep. Jax violated the man's rights against unreasonable searches and
seizures guaranteed by which Amendment?
the Fifth Amendment
O the Eighth Amendment
the Fourth Amendment
O the Sixth Amendment

Answers

Answer:

The Fourth Amendment.

From the Constitution:

The right of the people to be secure in their persons, houses, papers, and effects, against unreasonable searches and seizures, shall not be violated, and no Warrants shall issue, but upon probable cause, supported by Oath or affirmation, and particularly describing the place to be searched, and the persons or things to be seized.

I hope this helped!

HELP PLS
‘Economics is the study of the production and consumption of goods (and services) and the transfer of wealth to produce and obtain those goods.’

Please tell me what this statement is saying in your own words

Answers

Answer:

Economics is the study of the products that are used up. These products include food, water, and health products.  

what kind of vote is used to decide the president !!

Answers

Answer:

a candidate must receive a majority of electoral votes. im pretty sure.

Explanation:

(sorry if not correct.)

The president gets chosen by a electoral vote.

Explanation:

Match each term with the phrase that best defines it
balanced budget
amounts removed from gross income
to pay for taxes and other expenses
invest
expenses that are optional
withholdings
one in which expenditures are equal to
money earned
discretionary
to use money in a way that will
increase its value in the future

Answers

Answer:

Invest ~to use money...

Withholdings~ amount removed...

Balanced budget~ one in which

Discretionary~ expenses that are optional

Explanation:

Got correct answers

Balanced Budget- Expenditures are equal to money earned

Invest- Use of money in a way that will increase its value in the future

Withholding- Amounts removed from gross income to pay for taxes and other expenses

Discretionary- Expenses that are optional

What is Balanced Budget?

A balanced budget is a financial planning or the budgeting process where total expected revenues are equal to total planned spending.

This term is most frequently applied to public sector (government) budgeting.

A budget can also be considered balanced in hindsight after a full year's worth of revenues and expenses have been incurred and recorded.

What is Investment?

Investment means investing an asset to attain an increase in value over a period of time. Investment requires using present asset, such as time, money, or effort.

In finance, the purpose of investing is to generate a return from the invested asset which may consist of a gain (profit) or a loss realized from the sale of a property or an investment, unrealized capital appreciation (or depreciation), or investment income such as dividends, interest, or rental income, or a combination of capital gain and income.

The return may also include currency gains or losses due to changes in the foreign currency exchange rates.

Investors generally expect higher returns from riskier investments. When a low-risk investment is made, the return is also generally low. Similarly, high risk comes with a chance of high returns.

Investors are often advised to diversify their portfolio as it will be helpful in reducing the risk.

Withholding:

Withholding is the portion of an employee's wages that is not included in their paycheck but is instead remitted directly to the federal, state, or local tax authorities.

Withholding reduces the amount of tax employees must pay when they submit their annual tax returns. The employee's income, marital status, number of dependents, and number of jobs all determine the amount withheld.

Discretionary:

A discretionary expense is a cost that a business or household can survive without, if necessary.

Discretionary expenses are often defined as nonessential spending. This means a business or household is still able to maintain itself even if all discretionary consumer spending stops.

To learn more about Balanced Budget here

https://brainly.com/question/15865418

#SPJ3

Differentiate between sources of the law?

Answers

Answer: constitutions state and federal...

Explanation:

Is it illegal to support Christianity in russia

Answers

Answer:

No, they're are many Christian churches in Russia

But the government does put restrictions on what can be said and regulates it too

Please help with these 2

Answers

Answer:

3) D

4)C

Explanation:

They u go :) 3D 4C OWEHSOSEIUEJE

Many companies around the world have been convicted of corporate crimes. Why do you think companies engage in illegal activities? What do you think society should do to curb corporate crime?

Answers

Answer:

Many companies engage in illegal activities with the intention of bettering themselves. I think that society should pay more attention to corporations and how they get successful.

Explanation:

2. You were forced to leave your country; conditions were very harsh in
your new land.
3. You were expected to do something immoral to oppress another group.
4. You stood up for a group of people who were being oppressed and you
paid a steep price.
5. You did the right thing and it resulted in unpleasant consequences for
your friends.
6. You didn't believe when someone promised you that something good
would happen.
I
7. After you survived a difficult situation; you found yourself complaining
about little thing



Choose one of these situations you can mostly relate to and tell me about it please

Answers

Answer:

more people notbbe intresting with my home tjen not be like then i no need to stay with my country

then one of problem if any person or people poor the he leaves the country....

Which document prohibited Americans from fighting in the war between Great Britain and France?

Answers

Answer:

The diplomatic neutrality of the United States

Explanation:

Paragraph 2:
1. What cases refer to student rights in school?
2. What was the decision made in Tinker vs. Des Moines?
3. What was the decision made in Hazelwood vs. Kuhlmeier?
Paragraph 3:
1. What cases refer to rights of the accused?
2. What was the decision made in Gideon vs. Wainwright?
3. What was the decision made in Miranda vs. Arizona?
4. What was the decision made in In Re Gault?
Paragraph 4:
1. What cases refer to rights of citizens found in the 14th amendment?
2. What decision refer to Plessy vs. Ferguson?
3. What cases overturns Plessy vs. Ferguson?
4. What was the decision made in Brown vs. Board of Education?
Paragraph 5:
1. What Presidential cases has the Supreme Court reviewed?
2. What was the decision made in United States vs. Nixon?
3. What was the decision made in Bush vs. Gore?

Answers

Answer:

putting the learns at the center

Answer only if you know please and thanks. will mark brainliest

Answers

Answer:

I think its C but i dont know

Explanation:yea

Answer:

LOCALITIES

Explanation:

http://578125292684560794.weebly.com/constitutional-officers.html

if my son becomes a priest do i call him son or father

Answers

You call him a descendant.

(⌐■_■)

Depending on your relationship with him... actually I don’t know... just call him his respected title or maybe you should just ask him.

What did Anuradha Koirala do?​

Answers

Answer:

Explanation:

Anuradha Koirala (born 14 April 1949) is a Nepalese social activist and the founder of Maiti Nepal – a non-profit organization in Nepal, dedicated to helping victims of sex trafficking.

Does anyone know about or how to get emancipated I would really appreciate any information or any personal experience shared. thank you.

Answers

Answer:

(Might differ in different states!)

------

Generally :

You have the right to seek emancipation if you are ;

o 16 years old (I've also heard 14) ,

o live apart from you parents,

o are capable of financially supporting yourself,

-------------------

You will have to show you have an income and that it is enough to take care of yourself, such as ;

o pay for rent,

o groceries,

o transportation,

o a cell phone,

-------

Cost Wise :

Minor emancipation laws vary by state, but most state courts charge a filing fee of between $150 and $200. You must file the petition with the court and notify your parents or legal guardians (required by most states). Then the court will schedule a hearing.

------

Privileges :

It gives teenagers full legal capacity, including certain rights and duties usually reserved for adults. Therefore, emancipated minors can;

o sue their parents for support,

o make a will,

o sign a lease,

o buy, rent, sell, or take out a mortgage,

o can keep any and all income they earn,

o can make any and all healthcare decisions for themselves,

----

Disadvantages :

Becoming emancipated is like turning 18. You are considered an adult who is responsible for your own care, support, liabilities, and contractual obligations. While still an unemancipated minor, you are protected from certain legal actions against you, such as enforcement of contracts.

---------------

School :

For all practical purposes, once you're emancipated, you're completely on your own. ... Moreover, even if you're emancipated, you can't simply quit school. State laws vary, but typically a child can't drop out of school before age 16 and sometimes age 18. Those rules still apply to emancipated minors.

------

I got most of this off the internet. I'm not sure if all of this applies to every state. I forgot to add but you need parental consent since you are still a minor!

Hope this helps.

(Do your own research, especially on the disadvantages. If you're thinking about getting emancipated, make sure you doing it for all the correct reasons. I've thought about it, but it was just because of somethings that were going on, that were resolved a while later. <33 Good luck.)

Other Questions
What three dimensional shape is made when you rotate a triangle horizontally? Read and choose the correct verb in the preterite tense to complete the sentence.Nosotras ________ un buen viaje. tuve tuvo tuvimos tuviste In Act 3, Scene 1, Tybalt confronts Romeo and challenges him to a duel. What is the dramatic irony of this scene that motivates Romeo to forgive the insult by Tybalt? transcribe this strand of DNA 5' 3 TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid- Answer this PLZZZZZZ The Roman god Neptune and the Greek god Poseidon BOTH were considered to be the god ofA)war.B)time.C)the sea.D)the underworld A smoothie shop has 40 stores and 55% of the stores are in California. The rest of the stores are in Nevada. How many stores are in California? 22184595 Identify and explain three factors that contributed to the origin of the Cold War The ____________________ is the reproductive structure of gymnosperms. find the size of angle X. hi please help with my maths! a partir del texto,resuelvan las siguientes preguntas:A)En que ao se lanzaron las sondas voyager 1 y voyager 2 I NEED AN ANSWER ASAP. A brief summary of the career and contributions of James Galway and his flutist career what are the two elements found in silicon dioxide URGENT !!!!!!!!! Please answer correctly !!!!! Will be marking Brianliest !!!!!!!!!!!!!!!! URGENT !!!!!!!!! Please answer correctly !!!!! Will be marking Brianliest !!!!!!!!!!!!!!! y= 4/3x -8 4x-3y=24 A larger car takes more force to move._O Newton's 1st lawO Newton's 2nd lawO newton's 3rd lawO newton's 4th law Help on this question pleaseeeeeeee If the DNA sequence of bases is GGA-AAC, what is the mRNA sequence,