can someone help please?

Can Someone Help Please?

Answers

Answer 1
x=54 is the final answer
Answer 2

Answer:

x = 54

Step-by-step explanation:

In this line, I am going to assume lines l and m are parallel.

Each flat surface is half of a circle, therefore it has 180 degrees. We are given one side and told to find the other.

180 - 116 = 64.

The other angle's total value must be 64.

Now, to solve for x, subtract 10 from 64 [inverse operations].

64-10=54

The value of x in this equation is 54 degrees.


Related Questions

Please help quarter ends tomorrow and I don’t know what to do I’m failing all my classes

Answers

x+10*=4x-32*4x-x=32+103x=42*×=14*

14x4=56*-32*=24*

from E to B is 180 degree so take 180-24=156*

angle EMQ is equal to angle DMB so=156 degree

answ=156

CAN ANYONE PLS HELPPP ME!!!!!!!!!! ITS DUE!!

Answers

Answer:

I agree with Mary

Step-by-step explanation:

Cone:

r = 8/2 = 4 ft

h = 16 - 12 = 4 ft

Volume = [tex]\frac{1}{3}\pi r^{2}h\\[/tex]

             [tex]= \frac{1}{3}*3.14*4*4*4\\\\=\frac{200.96}{3}\\\\= 66.98\\\\= 67 cubic feet\\[/tex]

Cylinder:

r = 4 ft

h= 12 ft

Volume = πr²h

              = 3.14*4*4*12

            = 602.88

           = 603 cubic feet

Step-by-step explanation:

the formular for finding the volume( how much it can contain in this instance) of the cone(spout) is

[tex] \frac{1}{3} \times \pi \times {r}^{2} \times l[/tex]

r is the radius of the cone l is the height of the cone π = 22/7

1/3 × 22/7 × 4 × 4 × 4

diameter divide by 2 gives the radius 8/2 = 4

the height of the whole shape - the height of the upper part(cylinder) gives the height of the cone

16 - 12 = 4

volume of spout(cone)=22/21 × 64 =67 cubic feet(f^3)

Help me pls pls pls p

Answers

Answer:

L= 90, M=53, K=37

Step-by-step explanation:

Tilt your phone/computer to the right, and you'll see the 90° angle for L. Now you're left with two more, and just compare which angle is bigger, K or M. M is bigger, so you apply the bigger number out of the you got which is 53. Now no doubts, K is 37.

help please and thank you
!!

Answers

Answer:

f(x) = 2ˣ + 1

Step-by-step explanation:

Based on the exponential increase, you know that it will be an exponential equation, meaning that you can cancel out the first two options.

The easiest way to do pick the between the two remaining equations is by plugging in an x-value and seeing if the y-value for that equation matches the y-value from the equation.

For (3, 9):

f(x)  =  3ˣ  =  3³  =  27

f(x)  =  2ˣ + 1  =  2³ + 1  =  8 + 1  =  9

The last equation is the equation that is represented by the table.

Please I need some one to at least explain one of them so I can know how to do the rest

Answers

Answer:

Hope that answers your question

Factor the expression.

6x + 6

Answers

6(x+1) is the answer

Please help me ASAP

Answers

Answer:

B+4

Step-by-step explanation:

B + 4 or it can also be 4 + B


Hopefully I am right


Have a nice day! :)

A membership at Gisele’s Gym costs $145 to join and $3 for each visit. A membership at Freddie’s Fitness costs $75 to join and $5 for each visit. Which location has a lower total cost for different numbers of visits? Write each number of possible visits from the box into the correct column in the table to show whether one location has a lower total cost, or the same total cost as the other location.

Answers

Step-by-step explanation:

You can do the equation 145+3v for Gisele’s Gym

For Freddie’s Fitness do the equation 75+5v and put in the number of visits for v

For example, for 33 visits Freddie’s fitness has a lower cost than Gisele’s gym. You could do 3x33 + 145 = ? for Gisele’s gym, and do 5x33 + 75 for Freddie’s Fitness, and then compare which one has a lower cost. But technically I just gave you one answer and shown you what you could do.

I’m not particularly sure if I’m correct but that’s how I would do it, sorry for the long wait, if you have any questions you can ask me :)

I need help on this and the first person who answer correctly gets a BRANLIST​

Answers

Answer:

Inequality Form:

w  ≤  6

Interval Notation:

( − ∞ ,6)  

what does r equal?pls help me

Answers

Answer:

r ≥ -49/11

Simplified versions: r ≥ -4.45 or r ≥ -4 5/11

Answer:  [tex]r \ge -\frac{49}{11}[/tex]

r is greater than or equal to the fraction -49/11

==========================================================

Work Shown:

[tex]r + 5(-2r-10) \le -4r - 1 + 6r\\\\r - 10r - 50 \le -4r - 1 + 6r\\\\-9r - 50 \le 2r - 1\\\\-9r-2r \le - 1 + 50\\\\-11r \le 49\\\\r \ge \frac{49}{-11}\\\\r \ge -\frac{49}{11}\\\\[/tex]

Note how the inequality sign flips. This happens any time you divide both sides by a negative number.

help me pleaseeeeeeeeeeeeeeeee

Answers

Step-by-step explanation:

-d=0.8-1.5

-d=-0.7

d=0.7

Answer:

d=0.7

Step-by-step explanation:

1.5=d+0.8

d=1.5-0.8

d=0.7

Math multiple no calculator show work

Answers

Answer:

Step-by-step explanation:

8*9   and then  [tex]10^{5-11}[/tex]

72 * [tex]10^{-6}[/tex]

Please help need the answer now!!

Answers

Answer:

B

Step-by-step explanation:

A function can not have the same x-values but can have the same y-values. Because option B uses 0 as its x-value more than once, option B does not represent a function.

If this answer has helped you, please mark it as brainliest

PLEASE BEED HELP ASAP​

Answers

Answer:

1. Complementary Angles.

2. x=60°

Step-by-step explanation:

Part 1:

*Note: A complementary angle is when the sum of two angles equal 90 degrees. A Supplementary angle is when the sum of 2 angles equals 180 degrees.

In this instance, the 2 angles equal 90 degrees, as indicarted by the box on the angle. Therefore, the the angles are complentary.

Part 2:

1. Since we know that the sum of the two angles (x-30 and x) is 90 degrees, we can write an equation which says: (x-30) + x=90.

2. Then we'd simplify the equation by adding the like variables, and adding 30 to both sides:

2x=120

3. Now we will divide both sides by 2

[tex]\frac{2}{2} x=\frac{120}{2} \\x=60[/tex]

4. As a result, we get x=60, now label your answer with the degree sign, and enjoy your answer.

Use the distance formula to calculate the distance between the following two points:
(-1,1) and (4, 11)
The distance between the two points is approximately
units.

Answers

Answer:

d = 11 units if rounded to nearest whole number

Step-by-step explanation:

Distance formula:

d=√((x_2-x_1)²+(y_2-y_1)²)

Your ordered pairs (-1, 1) and (4, 11)

d=√((4-(-1))²+(11-1)²)

d=√((4+1))²+(10))²)

d=√((5)²+ 100)

d = √125

d = 11.18  

d = 11 units if rounded to nearest whole number

How Do I solve this? Answer too please.

Answers

The answer is 5/4 because that’s what you multiply the left triangle dimensions by to get the right triangle dimensions

help nowwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww

Answers

Answer:

I beleive is is -2% because 5 is 2 more than 3

so then 5-2=3

Answer:

Error Is 100(2/3) 66.7%


8. Is the discriminant positive, negative, or zero?

Answers

I think the answer would be negative. I’m sorry if I’m wrong

Answer: its positive !!!

Step-by-step explanation: got it wrong at first:(

Look at the system of equations below.
x- 2y = 4
y=4-x
Trevor stated that (4,0) is the solution to the system of equations. Joey stated that (0, -2) is the solution to the system of equations. Which
conclusion is true?

Answers

Answer:

Trevor is right

Step-by-step explanation:

The solution of system of equations are [tex](4,0)[/tex]

Therefore, Trevor conclusion is true.

System of equations:

Given system of equations;

                 [tex]x- 2y = 4\\\\y=4-x[/tex]

Substitute value of y from equation (2) in equation (1).

           [tex]x-2(4-x)=4\\\\x-8+2x=4\\\\3x=12\\\\\\x=12/3=4[/tex]

Substitute value of x in second equation.

 [tex]y=4-x=4-4=0[/tex]

Hence, the solution of system of equations are [tex](4,0)[/tex]

Learn more about the system of equations here:

https://brainly.com/question/13729904

help please, i don’t understand these’s type of problems

Answers

This is showing a corresponding pair of angles. So x would equal 34 degrees. (If it was a linear pair, it would be 180-34)

What does x equal when y=5

Answers

I think it’s uh I think it’s uh carrot yeah I think it’s a carrot

What is the solution to |x − 6| ≥ 5? A. 1 ≤ x ≤ 11 B. -11 ≤ x ≤ 1 C. x ≥ 11 or x ≤ 1 D. x ≥ 1 or x ≤ -11

Answers

Answer:

I think it would be A.

What is the slope of the line?

Answers

Answer:

1

Step-by-step explanation:

Two ordered pairs that can be seen are (0,1) and (1,2)

Using delta y/ delta x,

(2-1)/(1-0) = slope

slope = 1/1

slope = 1

Answer:

slope = 1

Step-by-step explanation:

To find the slope of the line, use the slope formula, [tex]m = \frac{y_2-y_1}{x_2-x_1}[/tex], in which [tex]m[/tex] represents the slope. The [tex]x_1[/tex] and [tex]y_1[/tex] represent the x and y values of one point, while the [tex]x_2[/tex] and [tex]y_2[/tex] represent the x and y values of another point.

Thus, locate two points on the line. We can see that the line intersects (-1,0) and (0,1), thus we can use them for the formula. (Any other two points that are also on the line will also work.) Substitute their x and y values into the appropriate places in the formula and solve:

[tex]m = \frac{(1)-(0)}{(0)-(-1)}\\m = \frac{1-0}{0+1} \\m = \frac{1}{1} \\m = 1[/tex]

Thus, the slope is 1.

Find X. please help or show me how to do it

Answers

Answer:

x = 63

Step-by-step explanation:

a triangle is always 180 degrees, so you equation would be:

180 - 42 - 43 - 32 = x

180 - 42 - 43 - 32 = 63

so x = 63

Answer:

Step-by-step explanation:

a straight line  = 180 degrees

on the right side, where the angle is 32 it is vertically opposite to the right angle of the triangle then

Brandy is watching a baseball game. So far, 8 out of 10 batters
have gotten a hit. What is the experimental probability that the
next batter will get a hit?

Answers

Answer:

8/10 aka 4/5 chance

Step-by-step explanation:

if 8/10 batters have hit the ball that means that the chance that the next ball is hit is 8/10, reduced its 4/5 chance or 80%

Mrs. Portillo cuts 1 /2 of a piece of construction paper. She uses 1/ 5 of the piece to make a flower. What fraction of the sheet of paper does she use to make the flower?

Answers

Answer:

1/2 x 1/5 = 1/10.

Step-by-step explanation:

Answer : fraction of the sheet of paper she use to make the flower is 1/10

Three semicircles are placed in a rectangle, as shown below. The width of the rectangle is 11m. Find the area of the shaded region. Use the value 3.14 for pi , and do not round your answer.

Answers

Answer:

para Es que yo soy español y no te entiendo

What is the percentage of 377 of 325?

Answers

Answer: 116%

Hope this helps.

While sorting some change into piggy banks, Gabby put 58 coins in the first piggy bank, 78 coins in the second piggy bank, 98 coins in the third piggy bank, and 118 coins in the fourth piggy bank. What kind of sequence is this?

Answers

Answer:  Whenever Gabby moves to different piggy banks, the banks will have 20 more coins than the one before.

Step-by-step explanation:

1     58

2     78

3     98

4     118

78-58=20

98-78=20

118-98=20

Whenever Gabby moves to different piggy banks, the banks will have 20 more coins than the one before.

Answer:

Step-by-step explanation:

20 more coins srry if this didn’t help

A necklace requires 25 beads to be completed.If kaylin has 7550 beads and each necklace cost $5 how much money will kaylin make?

Answers

Answer:

it is 1510 according to me and the calculator

Answer:

Kaylin can make $1510

Step-by-step explanation:

7550 beads ÷ 25 beads per necklace = 302 necklace in total

( or [tex]\frac{7550}{25} = 302[/tex] )

302 necklaces × $5 each = $1510 total

Other Questions
Identify the percent of change as an increase or a decrease: 1/3 to 2/3 Balanced or Unbalanced? Write a B for Balanced and a U for Unbalanced. ______ 11.CH4 + O2 CO2 + 2 H2O ______ 12. NaBr + CaF2 NaF + CaBr2 ______ 13. 4 Fe + 3 O2 2 Fe2 O3 PLEASE HELP ME! 50 POINTS! I WILL GIVE BRAINLIEST! Decide whether the table could represent a proportional relationship. If the relationship could be proportional, what would be the constant of proportionality?Bettie's Boutique is having a 20% off sale.|original price| sale price||$15. | $12. ||$25. |$20. ||$35. |$28. |- Solve the inequality 18 Hayley loves to shop for make up. She went to her favorite store and bought eye shadow for $5.99, 2 bottles of nailpolish for $7.50 each and a tube of mascara for $8.50. She had a 20% discount coupon. Create and solve an equation to determine how much was her purchase after the discount was applied. A bag contains 3 red, 5 yellow, and 7 purple marbles. Find the probability of drawing a purple marble followed by a red marble. The first marble is put back in the bag between draws. PLEASE HELP IM CONFUSED. Is this relation a function? Justify your answer.A. Yes, because every x-value corresponds with a single y-value. B. Yes, because every x- and y-value is positive.C. Yes, because the number of x values is the same as the number of y-values.D. No, because two points with the same y-value have different x-values. What is the order starting with where humans live what shape can be formed from the following net? Write three points about why driverless cars are a bad idea. Why do states spend more money on education than any parts of the government? *anyone can comment, this is just an opinion on why you think they spend more on education.. I need ideas for a project* Please answer!!! Ill make brainliest Find the exact value of x.Thank you Find the volume of the triangular prism in the picture shown. Round your answer to thenearest tenth. *1: 1672:77.3 yd3: 77 yd What three dimensional shape is made when you rotate a triangle horizontally? Read and choose the correct verb in the preterite tense to complete the sentence.Nosotras ________ un buen viaje. tuve tuvo tuvimos tuviste In Act 3, Scene 1, Tybalt confronts Romeo and challenges him to a duel. What is the dramatic irony of this scene that motivates Romeo to forgive the insult by Tybalt? transcribe this strand of DNA 5' 3 TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid- Answer this PLZZZZZZ The Roman god Neptune and the Greek god Poseidon BOTH were considered to be the god ofA)war.B)time.C)the sea.D)the underworld