Please help


What differentiates one layer of the atmosphere from one another?



Please help

Answers

Answer 1

Answer: The stratosphere and the troposphere are defined by the variation in temperature with height. Within a troposphere, the temperature drops as altitude increases, and drops fast enough for convection to occur. Whereas within a stratosphere, the temperature rises with increasing altitude. Features of the atmosphere change with altitude: density decreases, air pressure decreases, temperature changes vary. Different temperature gradients create different layers within the atmosphere. The lowest layer is the troposphere where most of the atmospheric gases and all of the planet's weather are located.

Explanation:


Related Questions

Investigation to find out relationship between the current in the coil and the force on the iron disc

Answers

Answer:

Electromagnets are made of coils of wire with electricity passing through them. Moving charges create magnetic fields, so when the coils of wire in an electromagnet have an electric current passing through them, the coils behave like a magnet.

Explanation:

HELP!! AM I CORRECT?? PLS TELL ME, IF U ANSWER PROPERLY I'LL GIVE U BRAINLIEST!!

Answers

Answer:ur right I think

Explanation:

Answer:

HON, i'm going to be honest, i'm not sure but it sounds like it is the Universal Expansion from what I learned about space

I'm sure this helps but if it doesn't DON'T GIVE ME BRAINLIEST, if it does then do

What is the geocentric angle of the earthquake focus?​

Answers

Answer:

epicenter

Explanation:

the epicenter Is d point directly above it at the structure of the earth

Which of the following is a compound? A)oxygen B)water C)nitrogen D)hydrogen

Answers

Answer:

water

Explanation:

water is a compound

The answer is water h2o

PLEASE HELP I HAVE FINALSSS​

Answers

Answer: 26.67 m/s

Explanation:

Given

Length traveled by the ball [tex]s=40\ m[/tex]

Time taken to reach the goal post is [tex]t=3\ s[/tex]

Initial velocity [tex]u=0\ m/s[/tex]

Using the second equation of motion

[tex]\Rightarrow s=ut+\frac{1}{2}at^2\\\Rightarrow 40=0+\frac{1}{2}a(3)^2\\\Rightarrow a=\frac{80}{9}\ m/s^2\\[/tex]

Now using

[tex]\Rightarrow v^2-u^2=2as\\\\\Rightarrow v^2-0=2\times \frac{80}{9}\times 40\\\\\Rightarrow v=\sqrt{\dfrac{80\times 80}{9}}=\dfrac{80}{3}\\\Rightarrow v=26.67\ m/s[/tex]

The velocity of ball will be 26.67 m/s

Calculating net force

Answers

Answer:

0N.

Explanation:

Net force is the sum total of forces acting on an object.

The Fn which is the net force is

450+ (-250) + (-600)+ 600+ 0 + 250 + (-450)

= 450-250+(-600)+ 600+0+250-450

= 0N

The net force is 0

Helppp!!!!! Please!!
A 0.144 kg baseball approaches a batter with a speed of 20m/s . The batter lines the ball directly back to the pitcher with a speed of 30m/s . Find the impulse exerted on the ball . If the bat and ball were in contact for 0.012 sec , find the average force exerted on the ball by the bat

Answers

Answer:

The impulse exerted by the ball is 7.2 kg.m/sThe average force exerted on the ball by the bat is 600 N.

Explanation:

Given;

mass of the baseball, m = 0.144 kg

velocity of the baseball, v₁ = 20 m/s

velocity of the batter, v₂ = -30 m/s (opposite direction to the ball's speed)

The impulse exerted by the ball is calculated as follows;

J = ΔP = mv₁ - mv₂

ΔP = m(v₁ - v₂)

ΔP = 0.144 [20 - (-30)]

ΔP = 0.144 ( 20 + 30 )

ΔP = 0.144 (50)

ΔP = 7.2 kg.m/s

The average force exerted on the ball by the bat is calculated as;

[tex]F = \frac{\Delta P }{t} \\\\where; t \ is \ time \ of \ contact= 0.012 \ s\\\\F = \frac{7.2}{0.012} \\\\F = 600 \ N[/tex]

a car is traveling north on the interstate. They cover 645 miles in 9 hours. What is the car's average velocity ?

Answers

Answer:

71.6 mph

Explanation:

you would do 645 divided by 9 which would give you 71.6

Explain the melting of a solid in terms of molecules and energy​

Answers

When you melt a solid the heat creates energy, when you heat up molecules they will move quicker and start to somewhat break apart into a liquid structure.

Heat generates energy when you melt a solid; as you heat up molecules, they move faster and begin to break apart into a liquid form.

What is the melting point?

The melting point is the point at which a substance transforms from a solid to a liquid.

The melting point of a liquid is the temperature at which it transforms from a solid to a liquid at atmospheric pressure. This is the point where the liquid and solid phases are in balance.

Heat generates energy when you melt a solid; as you heat up molecules, they move faster and begin to break apart into a liquid form.

The kinetic energy of the molecule is due to the movement of the molecule as the temperature of the system increases the melting point comes closer.

As the temperature increases the kinetic energy of the molecule increases.

Hence the energy, melting point, and temperature relatively affect each other.

To learn more about the melting point refer to the link;

https://brainly.com/question/12499685

To learn more about the melting refer to the link;

https://brainly.com/question/12499685

what determines the color of light?

1. wavelength
2. wave height
3. wave speed
4. wave amplitude

Answers

answer: wave length
(Please Mark brainly or like I’m trying to get points lol!)

Answer:

wave length

Explanation:

a wagon of mass 42 kg is pushed by a student a distance of 12.2 meters, and 297 j of work was sone on the wagon how much force did the student apply assuming that it was constant

Answers

Answer:

Force=2.484 N

Explanation:

[tex]f = \frac{w}{gh} \\ = \frac{297}{9.8 \times 12.2} \\ f = 2.484 \: n [/tex]

Hope it helped

PLS mark BRAINLIEST

A wagon of mass 42 kg is pushed by a student a distance of 12.2 meters, and 297 j of work was done on the wagon force did the student apply is 24.34 N.

What is force?

A force is an effect that can alter an object's motion according to physics. An object with mass can change its velocity, or accelerate, as a result of a force. An obvious way to describe force is as a push or a pull. A force is a vector quantity since it has both magnitude and direction.

work = force*distance

force = work/distance

force = 297/12.2

force = 24.34 N

A wagon of mass 42 kg is pushed by a student a distance of 12.2 meters, and 297 j of work was done on the wagon force did the student apply is 24.34 N.

To learn more about force refer to the link:

brainly.com/question/13191643

#SPJ2

i need help in (a) and (c)
please at least try​

Answers

I can’t see it can do next one again

I don't know please mark as brilliant

In your own words explain why the thickness and length of a wire could effect the flow of electrons​

Answers

Answer:

(you can use my exact words) The length and thickness would make it so that the electrons move differently than they would a shorter and thinner wire because with the wire being longer the electrons would have a longer trip and with the wire being thicker the electrons would be more spread out and move be able to move more freely

which of the following is an example of potential energy:
(choose 1)

- a printer that is not connected
- your cellphone, when you make a call to someone

Answers

A printer that is not connecting

While standing at home plate, a batter swung a 2.5kg bat at 2.5 m/s toward an incoming mass. The mass was a 0.4 kg blob of clay, thrown toward the batter at 26 m/s, which stuck the the bat in an inelastic collision. What velocity of the velocity of the bat and blob of clay (which are stuck together) after the collision? Help fast will give brainliest
Show work

Answers

Answer:

5.74 m/s

Explanation:

m1v1+m2v2=(m1+m2)*vf

2.5*2.5+0.4*26=(2.9)vf

16.65=2.9vf

vf=5.74 m/s

CAN A BRAINLEST HELP PLEASE!!!


The diagram below represents a rope along which
two wave pulses of equal amplitude, A, approach
point P

Answers

Might be A good luck

Use the scenario below for questions 4-7.
A rocket launched at a 60-degree angle has a launch velocity of
31.00 m/s.
4. What is the magnitude of the rocket's initial vertical velocity?
a. 10 m/s
b. 15.5 m/s
c. 26.85 m/s
d. 31 m/s

Answers

C is correct answer

The hot resistance of a 125V filament lamp is 500Ω. Determine the current taken by the lamp and its power rating.

Answers

Answer:

0.25 amps

Explanation:

V = IR

125 = I(500)

I = 0.25 amps

Why do some organisms never turn into fossils?
A. They are far too large to be buried in the ground.

B. They are made mostly of soft tissues.

C. They contain too much protein to be preserved.

D. They contain chemicals that prevent the hardening of their bodies.

Answers

Answer:

The answer is B.

Explanation:

Since they are made up of soft tissues, they decompose become they become fossils.

Another example of an object that has pressure energy

Answers

Answer:

A balloon?

Explanation:

it inflates because of the air pressure inside

F. A 50. A resistor (R2), and unknown resistor R2, a 120 Volt source, and an ammeter are connected in a
complete circuit. The ammeter reads 0.50 ampere (current).
R1
a. Determine the resistance of Rz.
R2

Answers

Complete question is;

A 50.-ohm resistor, an unknown resistor R, a 120-volt source, and an ammeter are connected in a complete circuit. The ammeter reads 0.50 ampere.

A) Calculate the equivalent resistance of the circuit shown.

B) Determine the resistance of resistor R shown in the diagram.

Answer:

A) R_eq = 240 Ω

B) R = 190 Ω

Explanation:

A) To get the equivalent resistance, we will use the formula;

R = V/I

Where;

V is Voltage

I is current

R is equivalent resistance

From the question, V = 120 V and I = 0.5A

Thus;

R_eq = 120/0.5

R_eq = 240 Ω

B) From the image, we see that the resistors are connected in series.

Formula for resistors in series is;

R = R1 + R2 +..... Rn

Thus;

240 = 50 + R

R = 240 - 50

R = 190 Ω

A) The equivalent resistance of the circuit shown will be  240 Ω.

B) The resistance of resistor R will be 190 Ω

What is resistance?

Resistance is a type of opposition force due to which the flow of current is reduced in the material or wire. Resistance is the enemy of the flow of current.

The given data in the problem is;

R is the resistance = 50.-ohm

v is the voltage = 120-volt source

I is the value of the current =0.50 ampere.

A) The equivalent resistance of the circuit shown will be  240 Ω.

According to ohm's law

[tex]\rm R= \frac{V}{I} \\\\ \rm R= \frac{120}{0.5} \\\\ \rm R=240 \ ohm[/tex]

Hence the equivalent resistance of the circuit shown will be 240 Ω.

B) The resistance of resistor R will be 190 Ω

The given resistors are connected in the series;

R = R1 + R2 +..... Rn

240 = 50 + R

R = 240 - 50

R = 190 Ω

Hence the resistance of resistor R will be 190 Ω

To learn more about the resistance refer to the link;

https://brainly.com/question/20708652

Can someone answer this form me i need help!!!

Answers

It decreased the speed
Decrease in speed I’m pretty sure

6. What is the resultant force on each car below? Remember TWO pieces of
information are needed.
7. What additional statement could we make about each car? Think about what key
words we could use

Answers

Explanation:

In first case, the forces on LHS and on RHS is the same i.e. 3 N. The force acting on the car is balanced force. As a result, the car will not move at all.

In second case,

Force on RHS = 2000 N

Force on LHS = -6000 N

Net force acting on it is given by :

F = 2000+(-6000)

= -4000 N

Hence, this is the required solution.

For an object falling at the terminal velocity, list all the forces (magnitude and direction) acting it?

Answers

Answer:

Three stages of falling

There are three stages as an object falls through a fluid:

at the start, the object accelerates downwards due to the force of gravity

as the object's speed increases, frictional forces such as air resistance or drag increase

at terminal velocity, the weight of the object due to gravity is balanced by the frictional forces, and the resultant force is zero

Explanation:

100%
Sutt S
Kam Scheela MARIO MARTINEZ-HTPhysics.pdf
Test BGK
HW#10
Question: A pinball machine's plunger has a spring constant of 22
N/m and is compressed by 0.04 m to start a 0.006 kg pinball.
1. What is the elastic potential energy before the ball is released?
2. What is the kinetic energy of the pinball the instant it leaves the
spring?
3. What is the speed of the pinball the instant it leaves the spring?
4. If the pinball is moving at 1.3 m/s as it is deflected horizontally
across the top of the pinball machine, how much higher above the
ground is this part of its path when compared to its starting
position?
Squation
Drawing
Ta
Signature
Instructions.

Answers

Answer:

1. The elastic potential energy is 0.0176 Joules

2. The kinetic energy of the pinball the instant it leaves the spring is 0.0176 Joules

3. The speed of the pinball the instant it leaves the spring is approximately 2.42212 m/s

4. The height of the part where the pinball is located on the machine above the ground is approximately 0.213 meters

Explanation:

The spring constant of the pinball machine's plunger, k = 22 N/m

The amount by which the pinball machine's plunger is compressed, x = 0.04 m

The mass of the pinball ball, m = 0.006 kg

1. The elastic potential energy, P.E. = 1/2·k·x²

By substitution, we get;

P.E. = 1/2 × 22 N/m × (0.04 m)² = 0.0176 J

The elastic potential energy, P.E. = 0.0176 J

2. At the instant the pinball leaves the spring, the plunger and therefore the force of the plunger no longer acts on the pinball

Since there are no external forces acting on the pinball to increase the speed of the pinball after it leaves the spring, the velocity reached is its maximum velocity, and therefore, the kinetic energy, K.E. is the maximum kinetic energy which by the conservation of energy, is equal to the initial potential energy

Therefore;

K.E. = P.E. = 0.0176 J

The kinetic energy of the pinball the instant it leaves the spring, K.E.= 0.0176 J

3. The kinetic energy, K.E., is given by the following formula;

K.E. = 1/2·m·v²

Where;

v = The speed or velocity of the object having kinetic energy K.E.

Therefore, from K.E. = 0.0176 J, and by plugging in the values of the variables, we have;

K.E. = 0.0176 J = 1/2 × 0.006 kg × v²

v² = 0.0176 J/(1/2 × 0.006 kg) = 88/15 m²/s²

v = √(88/15 m²/s²) ≈ (2·√330)/15 m/s ≈ 2.42212 m/s

The speed of the pinball the instant it leaves the spring, v ≈ 2.42212 m/s

4. The height of the pinball is given by the following kinematic equation of motion;

[tex]v_h[/tex]² = u² - 2·g·h

Where;

[tex]v_h[/tex] = The velocity of the pinball at the given height = 1.3 m/s

u = v ≈ 2.42212 m/s (The initial velocity of the pinball as it the spring)

g = The acceleration due to gravity ≈ 9.8 m/s²

h = The height of the pinball above the ground

We get;

[tex]v_h[/tex]² = 1.3² = 2.42212² - 2 × 9.8 × h

∴  h = (2.42212² - 1.3²)/(2 × 9.8) ≈ 0.213

The height of the part where the pinball is located on the machine above the ground, h ≈ 0.213 m

PLEASE HELPP IL GIVE BRAINLY AND HEART

if the land warms faster than the sea during the day, which breeze is experienced ( Assume during the day and that the land asd sea do not have the same temperature. )

A) Sea breeze
B ) Land breeze
C ) No breeze

Answers

Answer:

sea breeze

Explanation:

Answer:

A sea breeze

Explanation:

name one material through which continuous flow of charge can be produced from heat energy​

Answers

Answer:

A continuous flow of negative charges (electrons) creates an electric current. The pathway taken by a electric current is a circuit.

Explanation:

Answer:

Copper, and aluminum

Explanation:

The faster an object moves:
A the more potential energy it has.
B the more kinetic energy it has.
C the faster its particles vibrate.
D the cooler it gets.

Answers

The answer would be B

Answer:

b the more genetic energy

Please help ill give out brainliest?!!!

Answers

Air resistance because heavy object don’t get affect by air resistance than light object so
Because acceleration is inversely proportional to mass.

Sound travels Faster through _____________ mediums.

A) Denser
B) Less Dense
C) Colder
D) Sound always travels at the same period

Answers

Answer:

I know for sure that it's either A or B have a great day sorry I don't know which one completely

i think it’s A sounds travels faster through Denser mediums
Other Questions
what shape can be formed from the following net? Write three points about why driverless cars are a bad idea. Why do states spend more money on education than any parts of the government? *anyone can comment, this is just an opinion on why you think they spend more on education.. I need ideas for a project* Please answer!!! Ill make brainliest Find the exact value of x.Thank you Find the volume of the triangular prism in the picture shown. Round your answer to thenearest tenth. *1: 1672:77.3 yd3: 77 yd What three dimensional shape is made when you rotate a triangle horizontally? Read and choose the correct verb in the preterite tense to complete the sentence.Nosotras ________ un buen viaje. tuve tuvo tuvimos tuviste In Act 3, Scene 1, Tybalt confronts Romeo and challenges him to a duel. What is the dramatic irony of this scene that motivates Romeo to forgive the insult by Tybalt? transcribe this strand of DNA 5' 3 TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid- Answer this PLZZZZZZ The Roman god Neptune and the Greek god Poseidon BOTH were considered to be the god ofA)war.B)time.C)the sea.D)the underworld A smoothie shop has 40 stores and 55% of the stores are in California. The rest of the stores are in Nevada. How many stores are in California? 22184595 Identify and explain three factors that contributed to the origin of the Cold War The ____________________ is the reproductive structure of gymnosperms. find the size of angle X. hi please help with my maths! a partir del texto,resuelvan las siguientes preguntas:A)En que ao se lanzaron las sondas voyager 1 y voyager 2 I NEED AN ANSWER ASAP. A brief summary of the career and contributions of James Galway and his flutist career what are the two elements found in silicon dioxide