A RESEARCHER, WHILE ISOLATING AN ENZYME, FINDS AN INCREASE IN THE ACTIVITY OF THE ENZYME, AFTER A SPECIFIC PHASE THE SITUATION. HOW DO YOU THINK YOU CAN EXPLAIN THIS INCREASE OF TOTAL ACTIVITY?
Answers
The enzyme of this exercise could have increased its activity after their isolation, due to an increase in the substrate this enzyme acts on. For example, after we eat our food at dinner, the concentration of our bodies' insulin increase, due to a higher concentration of glucose from that aliments provenience from the digestion on our stomachs. This also can cause a positive feedback reaction in our bodies, which means that a little amount of enzyme, can produce more of this molecule, and they are those kinds of metabolic processes which usually are involved in maintaining our bodies' homeostasis.
We can see an example of this in the following picture, where the presence of a substrate, activates the enzyme.
Related Questions
need help fast!!!
Which is a characteristic of the part of the atom marked "B”?
Answers
Answer:
Its either electron cloud or empty space.
Explanation:
I hope this helps. if it's one of the two please tell me. :))
What are some possible components of the pus found in the middle ear? how does this produce the redness of the eardrum? how does this relate to fever?.
Answers
Fluid buildup in the middle ear can be caused by swollen eustachian tubes.
Pus is an indication of infection. Pus after surgery indicates a post-operative complication in the form of an infection. People who notice a pus discharge after surgery should contact their doctor right away.
Depending on the cause of your infection, antibiotics or antifungal medication may be required. For temporary relief, your doctor may also prescribe pain medication. It is not recommended that you soak your ear, swim, or use ear plugs or earbud headphones while treating this infection.
Abscesses, if left untreated, can cause an infection that spreads throughout your body and can be fatal.
To learn more about ear infections, here
https://brainly.com/question/3897351
#SPJ4
Which b. f. skinner invention allowed him to train subjects through operant conditioning? a. cumulative recorder b. operant chamber c. pigeon box d. cat puzzle box please select the best answer from the choices provided a b c d
Answers
The operant conditioning chamber, sometimes known as the "Skinner Box," was created by Skinner to carry out his empirical methodology.
What is the skinner box?
In the Skinner Box, where isolated subjects like rats and pigeons may be exposed to carefully controlled stimuli. An instrument used in laboratories to examine animal behavior is called an operant conditioning chamber. While a graduate student at Harvard University, B. F. Skinner developed the operant conditioning chamber. Both classical and operant conditioning can be studied in the chamber.
Hence, the answer is b. operant chamber
To learn more about skinner box, follow the link: https://brainly.com/question/29461281
#SPJ1
Explain how used the fossil, rock and glacier evidence to help you form Pangaea
Answers
Answer:
Glacial deposits are glacial landforms developed by big rocks collected in the landscape region due to the withdrawal of glaciers.
Explanation:
Why is the era of nucleosynthesis so important in determining the chemical composition of the universe?.
Answers
The nucleosynthesis era is significant because it is when the nuclear fusion process produced all of the primordial hydrogen and helium.
Why is the nucleosynthesis era crucial for understanding the universe's chemical makeup?The chemical makeup of the universe is the same today as it was at the end of the nucleosynthesis epoch, with the exception of a minuscule quantity of matter created subsequently by stars.
Why is nucleosynthesis important? What is it?The process of creating new atomic nuclei—the protons and neutrons that make up an atom's center—is known as nucleosynthesis. Within a few minutes after the Big Bang, the process of nucleosynthesis began. At that time, a soup of quarks and gluons known as a quark-gluon plasma condensed into neutron and proton.
To know more about nucleosynthesis visit:-
https://brainly.com/question/14123267
#SPJ4
Which molecule is most common in the human body?
A. H₂
B. N₂
C. H₂0
D. CO₂
Answers
Answer:
c) H₂0
Explanation:
H₂0 molecule (water) is the most common molecule in the human body. Hence, option (c) is the correct answer.
compare the wave shape of an alligator’s low-frequency mating call with the wave shape of a frog’s high-frequency chorus. How are the shapes different
Answers
The comparison of the wave shape of an alligator’s low-frequency mating call with the wave shape of a frog’s high-frequency chorus in the way that their shapes are different is that The high-frequency shapes are relatively close together whereas the low-frequency waves are spaced out.
What is the mating call about?American alligators aren't afraid to make their presence known when they're looking for a mate, and the outcome might sound like a cross between a motorcycle and the loudest snorer ever. An image of a huge male making one of its loud grunting mating sounds is captured on camera.
So, Odorrana tormota and Huia cavitympanum are two species of frogs that are currently recognized for their ability to vocalize at high frequencies, or even partially ultrasonically. Both individuals' hearing systems have been specially modified so they can hear in the high-frequency band.
Therefore, While the high-frequency patterns are closely spaced apart, the low-frequency waves are elongated in both animals.
Learn more about low-frequency from
https://brainly.com/question/21890312
#SPJ1
what are the characteristic features of the arthropods? what are the advantages and disadvantages of these features
Answers
Main characteristic features of the arthropods is that their exoskeleton is made of chitin and circulatory system is open.
Characteristics:
The body is trigerminated, segmented, and bilaterally symmetrical.They show the tissue level of the organ system.The body is divided into head, thorax and abdomen.Their bodies have articulated appendages that help them move.The body cavity is filled with blood.Terrestrial arthropods secrete from the malpighian tubules, whereas aquatic arthropods secrete from green or coaxial glands.They are unisexual and fertilization is either external or internal.They have a well-developed digestive system.Breathe through the general body surface or trachea.Advantage:
Arthropods are layers of wax that prevent dehydration and prevent the body from drying out
Disadvantage:
The exoskeleton cannot grow. As the animal grows, it must molt or molt the exoskeleton and wait for the underlying new exoskeleton to harden.
Learn more about arthropods from:
https://brainly.com/question/2244172
#SPJ4
what does atg in the liam/elijah coding sequence of dna correspond to in the mrna and resulting amino acid chain? what does tac in the leah/jenny template sequence of dna correspond to in the mrna and resulting amino acid chain?
Answers
The atg in the liam/elijah coding sequence of DNA correspond to in the mrna and results into Elijah: UAU, UCU, CAA, CCC, GAU and liam: UGU,UCA, UAA, CCU, GAG.
What is coding sequence and amino acid chain and what does tac in the template sequence correspond to?Coding sequence is a sequence of DNA which codes for a particular character and even this is sequence which proceed further in the generation.There are non coding sequences also which are excised later in the process by removal enzymes and the coding sequences are proceeded further for the process.Here the question is asked of the atg in the liam/elijah who are brothers and the coding sequence of DNA correspond to in mRNA and resulting amino acid chain too and the tac in the DNA template too.Well the resulting amino acid chain in would be Elijah: UAU-UCU-CAA-CCC-GAU and the amino acid sequence in Liam would be UGU-UCA-UAA-CCU-GAG.Hence the amino acid sequence in the two brothers are so as mentioned in the point above and the amino acid sequence is initial progenitor for the mRNA processing.To know more about mRNA visit:
https://brainly.com/question/12903143
#SPJ4
What are the 2 types of cells????
Answers
Answer:
The two types of cells are prokaryotic and eukaryotic.
Answer:
Prokaryote and Eukaryote Cells
Explanation:
What is a Prokaryote Cell?A prokaryote cell is a cell which has no nucleus or membrane-bound organelles.
What is an Eukaryote Cell?A Eukaryote cell is a cell which has a nucleus and membrane-bound nucleus.
What's a chart to help you identity cells.Scientist use a dichotomous key to determine scientific names of things and it helps determine which cell is which.
To learn more about Prokaryote and Eukaryote Cells visit
https://brainly.com/question/6871687
To learn more about dichotomous keys visit
https://brainly.com/question/16333970?referrer=searchResults
3. What is the purpose of having so many different kinds of proteins on the
surface of cells? How does the cell know how to make those proteins (where is
the "recipe") and how are those proteins made?
Answers
Answer: See Below
Explanation:
The proteins on the cells surface are vital for numerous cellular processes. They can be used to intake or export nutrients and waste. They can also be use for ligand-receptor binding for cell to cell signaling. Proteins on the surface also act to regulate gene expression based on all kinds of different environmental stimuli.
The recipe for these proteins are in the DNA of the cell. All of the cells in our body contain essentially the exact same DNA. Cells differentiate by various gene regulation mechanisms. Cells in our body will have different types of proteins depending on the type of cell that they are. Gene expression for these surface proteins is highly specific and is governed by various regulatory mechanisms such as activators and repressors.
If a surface protein is needed then it will be transcribed into mRNA and then translated into a protein and transported to its proper location within the cell membrane.
b1.2 what do you think will happen if we test the shell of the modern edible oyster crassostrea virginica with acid?. what do your results imply about the magnitude of evolutionary change in shell mineral composition in oysters?
Answers
Since carbon dioxide is being produced as a byproduct of the reaction, the substance will fizz or bubble. Calcium carbonate is present because of this bubbling or effervescence.
How does oyster recruitment work?The process of adding new oysters to a population is called recruitment. Millions of tiny larvae are produced by adult oysters during the summer. Young oysters permanently cement to hard surfaces, preferably other oyster shell, after a two- to three-week period of free swimming.
How many clients has Oyster HR served?The Oyster platform is used by almost 1,000 small and medium-sized businesses, most of which are located in the United States and Europe (about 90%). Quora, Lokalise, and Jobbatical are a few of the clients.
To know more about oyster crassostrea visit:-
https://brainly.com/question/28800868
#SPJ4
May I please get help with question one. I also need to provide an example and understandable response in my explanation. The specialized cells in this lab are… abseission layer, sperm, corn root, cerebral cortex, vein/valve, kidney, bone marrow, muscle, sweat gland,
Answers
Multicellular organisms are made up of more thaan one cell, with groups of cells differentiating to take on specialilzes functions. Unicellular organisms are made up of only one cell that perform all of the functions needed by the organism.
Multicellular organisms gave set if cells that specialize in reproduction which is usually sexual. During fertilization, when an egg and spoerm fuse, the resultant zygote is considered to be unicellular.
There is no excretory organs in a unicellular organisms. They remove their waste by simple diffusion from the body surface to the surrounding water. In multicellular organisms, excretion occurs by specialised organs called kidney.
What factor determines when an animal species will enter an ecosystem insuccession?A. Food availabilityB. PioneersC. CompetitionD. Minerals
Answers
Ecology: Ecological succession
Ecological succession is the process of change in the species present in an ecosystem over time.
There are two types of succession:
• Primary succession,, where an area that hasn't had any life before begins to be colonized, such as a new island.
,• Secondary succession,, where there is a disturbance, such as a fire, that removes the organisms living in that area.
The changes in plants depend on changes in the soil and interactions with other organisms, such as competition for light with other plants and feeding from herbivores.
On the other hand, the changes in animals depend on sources of food and predation interactions.
This means the correct answer would be A. Food availability.
which one could produce a sperm with two x chromosomes: nondisjunction during meiosis 1 or nondisjunction during meiosis 2?
Answers
Nondisjunction during meiosis 2 could produce a sperm with two x chromosomes.
Nondisjunction can occur during meiosis I and meiosis II, resulting in an abnormal gamete chromosome number. The main difference between meiosis 1 and meiosis 2 nondisjunction is that meiosis 1 does not separate homologous chromosomes, whereas meiosis II does not separate sister chromatids.
Nondisjunction means that the pair of homologous chromosomes did not separate or did not separate at anaphase so that both chromosomes of the pair end up in the same daughter cell. This probably occurs most frequently in meiosis, but can occur in mitosis to create mosaic individuals.
Meiotic nondisjunction can result in pregnancy loss or the birth of children with extra chromosomes in every cell, whereas mitotic nondisjunction results in mosaicism of two or more cell lineages. Aneuploidy can also result from late delay.
Learn more about meiosis from:
https://brainly.com/question/29383386
#SPJ4
39. Mice only store a small amount of energy from the the plants they eat. State what might happen to some ofthe remaining energy they obtain from their food.
Answers
The mice stores part of the energy from food and utilize the rest in their daily life activities. Some of the energy is stored in the form of fat for the mice have a better control of the exchanges of temperature with the environment, other part of this energy is used to make the systems in the mice body work (cells, tissues, and all the structures of the mice body). The energy from food is in the form of macromolecules that are cleaved in smaller molecules and nutrients that will be used for the process of making all components of the body works. Even the small amount of energy that is stored needs to be comcompartimentalized, and for that the mice use the energy "to spend". To the living organisms food energy is a essential need, because without disponible energy the organism can not work properly.
Define polar molecule or polarity.This is not a test question, could you please simplify the response to as few sentences as possible?
Answers
Polarity is caused by electronegativity. Electronegativity is the ability of an atom to attract electrons and when in a molecule there is a region of low electronegativity and a region of high electronegativity we say that the molecule is polar.
Which force binds the nucleus together despite the fact there are protons in close proximity to each other?.
Answers
Nuclear power's potent force. Protons can stick together in a nucleus even if their charges repel one another because it is stronger than electrostatic repulsion at very close ranges.
What is the mechanism that holds the nucleus collectively?The nuclear force, an inter-nucleon short-range force, is what binds a nucleus together. Protons and neutrons are prevented from colliding by the nuclear force's repulsive nature, which acts at very tiny distances.
What force holds the protons and neutrons in a nucleus together?Along with gravity, electromagnetism, and the weak nuclear force, the strong force is one of the four fundamental forces of nature. The atom's nucleus is one of the densest structures because the strong interaction connects protons and neutrons there.
To know more about nucleus visit:-
https://brainly.com/question/17704494
#SPJ4
Yeast is a unicellular organism that undergoes fermentation, a type of anaerobic respiration, to convert sugar into alcohol and carbon dioxide. In an experiment testing yeast activity, Sakurapoured equal amounts of warm water into two bowls. She added 1 teaspoon of sugar to only one bowl. Next, she added 1 teaspoon of yeast to each bowl. Within a few minutes, bubblesstarted to rise to the top of both bowls. Which of the following best explains why Sakura observed more bubbles produced in the bowl with sugar than in the bowl without sugar?A.Sugar provided the chemical energy for driving photosynthesis, resulting in greater production of oxygen bubbles.B.Sugar provided the light energy for driving cellular respiration, resulting in greater production of oxygen bubbles.C.Sugar provided the light energy for driving photosynthesis, resulting in greater production of carbon diaxide bubbles.D.Sugar provided the chemical energy for driving cellular respiration, resulting in greater production of carbon dioxide bubbles.
Answers
The correct answer is D. Sugar provided the chemical energy for driving cellular respiration, resulting in greater production of carbon dioxide bubbles. Sugar is a chemical used by heterotrophic organisms to perform cellular respiration, which ultimate product is carbon dioxide (CO2).
all fuels are sources of energy
Answers
Answer:
they are usually considered to be a primary energy source.
Explanation:
select the features that would be compared. select all that apply. select the features that would be compared.select all that apply. photosynthetic pigments cytological features aspects of physiology type of motion type of nutrition morphological traits
Answers
Cytological features can be compared. Cytological analysis focused on both cytomorphological architecture and individual nuclear functions.
What is the cytological method?Cytological techniques are methods used to study or manipulate cells. It includes methods used in cell biology to culture, track, phenotype, sort, and screen cells within populations or tissues, and molecular methods for understanding cell function. increase.
What is cell biology and why is it called cytology? A branch of biology concerned with structure, function, proliferation, pathology, and life history of cell is called cell biology or cytology.The field cytology was founded in 1928 by George Nicholas Papanicolaou. Cytopathology is generally applied to samples of free cells or tissue fragments, in contrast to histopathology, which examines whole tissue. Cytopathology is often called, less precisely, "cytology," which means "study of cells."To learn more about cytology visit:
https://brainly.com/question/10865552
#SPJ4
In the experiment described in the animation, why did the investigators add a mutagen to the culture medium?.
Answers
In the experiment described in the tutorial, the investigators add a mutagen to the culture medium to increase the rate of evolutionary change in the viruses.
What is mutagen?Any factor that results in a mutation (a change in the DNA of a cell). Mutagens can injure cells and cause some diseases, like cancer, by altering DNA. Radioactive elements, x-rays, ultraviolet rays, and certain compounds are examples of mutagens.
What is a virus?A virus is an infectious microorganism made up of a protein-coated segment of nucleic acid (either DNA or RNA). A virus can't multiply by itself; it has to infect cells in order to utilize the host cell's components to make copies of itself. Viruses are composed of bundles of DNA or RNA that are encased in a protein capsule called a capsid. Infectious agents that are acellular and must exist in the presence of a host cell in order to grow, viruses are frequently referred to as obligatory intracellular parasites. All cell types, including those in people, animals, plants, bacteria, yeast, archaea, and protozoa, have been proven to be susceptible to certain viruses.
Thus from above conclusion we can say that in the experiment described in the tutorial, the investigators add a mutagen to the culture medium to increase the rate of evolutionary change in the viruses.
Learn more about the virus here:
https://brainly.com/question/25236237
#SPJ1
A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write the mRNA that would be transcribed from this DNA fragment.b) Circle the starter and the stopper in your mRNA sequence. Write the sequence of amino acids which would be encoded in translation. Use the mRNA codon table provided.c) Where in the cell do transcription and translation occur?
Answers
a) In order to transcribe the segment of DNA, it is important to note that this process is important for gene expression as a protein. An enzyme called RNA polymerase moves along the DNA until the end of the gene, releasing the mRNA. The DNA has two strands: one that goes from 5' to 3' direction, and another one that goes from 3' to 5' direction. The one that's used for transcription will always be the 3' to 5' one, so we already have the correct strand to work with, as it is a 3' to 5' strand.
However, the mRNA will be assembled in the 5' to 3' direction. Using the same complementary base-pairing rules as in DNA, we will pair Cytosine (C) with Guanine (G), but as there is no Thymine (T) in RNA, we will pair Adenine (A) with Uracil (U).
Therefore, the sequence o mRNA read in the 5' to 3' direction is:
5' CUAUGGAAACACAUCAGUAGAA 3'
b) The starter codon is the AUG codon of a messenger RNA (mRNA). Therefore, the sequence of amino acids will start to be decoded there.
The stopper codon can be one of the three following options: UAA, UAG or UGA. In this case, we can only find the UAG codon.
The codons, then will be:
AUG GAA ACA CAU CAG UAG
Then, we can say that the amino acids translated will be:
Met Glu Thr His Gln
(Methionine - Glutamine - Threonine - Histidine - Glutamine
c) In eukaryotes, transcription occurs inside the nucleus of the cell and translation occurs in the cytoplasm.
a particular small noncoding rna that is linked to spermatogenesis is most likely classified as what kind of noncoding rna?
Answers
The correct option is D : piwi-interacting RNAs . Animal gametogenesis and fertility are greatly influenced by PIWI-interacting RNAs (piRNAs), which also suppress transposons, fight viruses, and regulate endogenous genes1.
Animals' PIWI-interacting RNAs (piRNAs), which range in length from 21 to 35 nucleotides, suppress transposable elements, control gene expression, and thwart viral infection. PiRNAs direct the PIWI proteins to cleave the target RNA, encourage the construction of heterochromatin, and methylate DNA. The piRNA pathway's architecture enables it to control conserved host genes in addition to providing adaptive, sequence-based immunity to transposons and viruses that are continually developing. While somatic piRNA activities have been lost, gained, and lost again during evolution, piRNAs silence transposons in the germ lines of the majority of mammals.
Learn more about to noncoding rna visit here:
https://brainly.com/question/15943629
#SPJ4
Full Question ;
A particular small noncoding RNA that is linked to spermatogenesis is most likely classified as what kind of
noncoding RNA?
A) short interfering RNAs
B) bidirectional lncRNAs
C) microRNAs
D) piwi-interacting RNAs
18. As part of an experiment, a light source is placed next to a plant. After a few days, the plant is growing toward
the light. The light acted as a(n)..
a. stimulus
b. response
c. growth
d. defense
Answers
Answer:
The answer is A, stimulus
Asbestos fibers cause a cancer called mesothelioma in humans. The fibers kill cells that line lung tissue by causing programmed-cell death. When cells die this way, they release a chemical, HMG1, which causes an inflammatory response in other cells. During this inflammatory response, cells release chemicals that promote tumor growth. What conclusion can you draw about the chemicals released in the inflammatory response? A. They decrease the amount of HMG1 in a feedback loop. B. They increase the amount of HMG1 in a feedback loop. C. They disrupt the normal circadian rhythms. D. They disrupt the normal cell cycle.
Answers
The conclusion that we can draw about the chemicals released in the inflammatory response is that HMG1 acts as a mediator of acute lung inflammation might leads to lung cancer, such as mesothelioma. The presence of HMG1 causes cells to release certain chemicals that promote tumor growth.
What is Asbestos Fibers and Mesothelioma?Asbestos has a crystalline category of naturally occurring silicate fibers. These fibers are only visible under a microscope. Asbestos harms lung tissue cells by inducing programmed cell death.
When cells die in this way, they produce HMG1 (high mobility group proteins that promotes an in other cells. The presence of HMG1 causes cells to release certain chemicals that inflammatory reactionpromote tumor growth.
Therefore, The presence of HMG1 causes cells to release certain chemicals that promote tumor growth.
Learn more about tumor on:
https://brainly.com/question/12020868
#SPJ1
Provide examples of other organisms if possible that belong to the same kingdom?
the organism is a dog
Answers
Answer:
All Animals are part of this kingdom
Humans
Cow
Cat
Horse
Donkey
Tiger
Lion
Panther
Leopard
Cheetah
Bear
Elephant
Polar bear
Turtle
Tortoise
Crocodile
Rabbit
Porcupine
Hare
Hen
Pigeon
Albatross
Crow
Fish
Dolphin
Frog
Whale
Alligator
Eagle
Flying squirrel
Ostrich
Fox
Goat
Jackal
Emu
Armadillo
Eel
Goose
Arctic fox
Wolf
Beagle
Gorilla
Chimpanzee
Monkey
Beaver
Orangutan
Sensing systems incorporated into harvesting machines that register and record amounts of harvests associated with specific portions of a planted field are called monitoring systems.
Answers
Crop monitoring makes use of space-based data to keep tabs on crop development and forecast crop yields for certain fields that have been planted.
What is monitoring systems?A system for monitoring agriculture consists of a network with wireless sensors. These sensors gather information from several nodes positioned on the playing surface. Then, specialists or nearby farmers analyze this data. The data can be used to make a number of inferences about weather patterns, soil fertility, crop quality, etc. A system is developed for agricultural field monitoring in IoT-based modern agriculture with the aid of sensor like light, humid, temperatures, soil moisture, etc. Farmers may monitor the condition of thier fields from any location. IoT-based smart farming is considerably more efficient than conventional farming.
How do farmers monitor their crops?Nowadays, satellite techniques are widely employed in agriculture, and many farmers use them frequently to observe their fields and assess the condition of their crops. Crop monitoring is crucial for managing various pests, weeds, and diseases that affect crops. This gives information about the crop's current situation, and you can then look ahead in time to forecast what will probably be the crop's next problem.
To know more about Monitoring Systems visit:
https://brainly.com/question/28776835
#SPJ1
25. Which of the following correctly describes the sequence of events used to help humans remember
information?
a. encoding- storage- retrieval
b. storage- encoding -retrieval
c. encoding- retrieval -storage
d. retrieval- storage- encoding
Answers
Answer:
encoding storage and retrieval
Explanation:
Encoding is defined as the initial learning of information; storage refers to maintaining information over time; retrieval is the ability to access information when you need it.
6. Analyze How can the introduction of nutria affect a pond ecosystem food web?
Answers
The introduction of nutria affects a pond ecosystem food web because the saltwater marshes are destroyed by Nutria's ravenous eating habits.
Nutria's ravenous appetite for food causes the destruction of saltwater marshes, which reduces the amount of food and shelter available to other species and promotes severe erosion.
By devouring the wetland grasses, Nutria devastates the area's food chain and environment. A few invasive species seriously hurt the economy. The amount of above- and below-ground plant matter that nutria consume daily can reach up to 25% of their body weight.
Nutria obliterates the banks of ditches, lakes, and other bodies of water in addition to harming vegetation and agriculture. What's most important, though, is the long-term harm that nutria may do to wetlands like marshes.
To learn more about Nutria visit: https://brainly.com/question/17690670
#SPJ9