2. The volume of a 3-D shape is 13 cubic feet. The shape is scaled up and the new volume is 832 cubic
feet. What was the scale factor?

Answers

Answer 1

Scale factor of given equation is 64 : 1

What is scale factor ?Scale Factor is used to scale the shape in various dimensions. In Geometry you will learn about different geometric shapes  in 2D and 3D. A scale factor is a measure of similar figures that look the same but have different scales or measurements. Suppose two circles are similar but may have different radii. The scale factor indicates how much larger or smaller the  figure is  than the original figure. Scale allows you to scale the  original shape up or down and draw it. The amount by which a shape is magnified or shrunk is called the scale factor. Used when you need to increase the size of  2D shapes such as circles, triangles, squares, and rectangles. Magnification is also well understood from the basic theorem of proportionality.Calculation

initial volume = 13  cubic feet

final volume = 832 cubic feet

scale factor = 832 / 13

                    = 64 : 1

learn more about scale factor here :

brainly.com/question/22312172

#SPJ1


Related Questions

This the photo and I need you to answer this question

Answers

Given:

The graph shows the prices of the current year for the number of bushels.

And the table shows the prices of the previous year.

Part A: We will find the rate of change of bushels of corn in the current year.

As the graph shows a line, so, the rate of change will be the slope of the line

We will find the slope using two points.

As shown the line passes through the points (0,0) and (3,24)

So, the slope will be as follows:

[tex]slope=\frac{24-0}{3-0}=\frac{24}{3}=8[/tex]

So, the rate of change = $8 per Bushel.

Part B: How many dollars more in the price of a bushel of corn in the current year than the previous year.

From the table: the price of the previous year = 21/3 = $7

And form the graph, the price of the current year = $8

So, the differnce = 8 - 7 = $1

So, the answer will be:

$1 more is the price of the current year than the price of the previous year.

Kevin runs a café. Every day the café is open he earns money in sales and spends money on supplies. After costs, how much more money did Kevin make on Saturday than on Friday?

Day Sales:
Monday $512.87
Friday $735.90
Saturday $807.31

Supply Costs
$200.92
$232.86
$289.00​

Answers

Answer:

  $15.27

Step-by-step explanation:

You want to know how much more profit Kevin made on Saturday than on Friday, if his revenue and expenses for the two days were ...

Saturday: $807.31 revenue; 289.00 expensesFriday: $735.90 revenue; $232.86 expenses

Profit

The profit each day is the difference between revenue and expenses:

  Saturday profit = $807.31 -289.00 = $518.31

  Friday profit = $735.90 -232.86 = $503.04

Difference

The profit on Saturday exceeded the profit on Friday by ...

  $518.31 -503.04 = $15.27

Kevin made $15.27 more on Saturday than Friday.

<95141404393>

Question 1 (1 point)
What is the mode of: 3.7, 5, 9.2, 4, 6.1, 5, 2.6, 4, 5.2, 5?
O a
Ob
Oc
Od 5
4.88
6.6
4.5

Answers

the mode is 5 i don't understand what the the other part is

Write the coordinates of the verticals after a rotation 270 counter clockwise around the origin
D=
E=
F=
G=

Answers

Check the picture below.

Use the figure below to answer Parts A, B and C. Provide your responses to EACH
part in the textbox below.



Part A: If the missing coefficient in the empty box is -7, what is the perimeter of
the shape? Make sure to include the measurement in your final answer.
Part B: If the perimeter of the shape is 5x²+8x + 4 inches, what coefficient is
missing from the box?
Part C: Using the perimeter from Part B. evaluate the perimeter of the shape when
3. Make sure to include the measurement in your final answer.

Answers

Using the perimeter concept, the measures are given as follows:

a) Perimeter when the missing box is of -7: -6x² + 8x + 4.

b) Coefficient missing when the perimeter is of 5x² + 8x + 4: a = 4.

c) Perimeter from part B when x = 3: 73 inches.

How to obtain the perimeter of a figure?

The perimeter of a figure is obtained by the sum of their outer side lengths.

For this shape, these lengths are given as follows:

3x.x² + 5.ax² + x.4x - 1.

With a missing coefficient of a = -7, we have that:

ax² + x = -7x² + x.

Hence the perimeter is:

3x + x² + 5 - 7x² + x + 4x - 1 = -6x² + 8x + 4.

In symbolic terms, the perimeter is:

(1 + a)x² + 8x + 4.

When the perimeter is of 5x²+8x + 4, the coefficient is:

1 + a = 5

a = 5 - 1

a = 4.

When x = 3 and a = 4, the perimeter is given as follows:

P = 5(3)² + 8(3) + 4 = 73 inches.

More can be learned about the perimeter of a figure at https://brainly.com/question/19819849

#SPJ1

Zavier and Maria shared 70 books, Zavier had 2 more books than Maria, how many did Maria have?​

Answers

Answer:

Zavier had 37 books, and Maria had 33 books

Step-by-step explanation:

You take 70 and divide it by 2 (cause you are only dividing the books up to maria and Zaviar); this will give you 35 books to each person EXCEPT Zavier has two more books to his pile, so you subtract two books from Marie and add it to Zaviers!

Evaluate inverse functions The graph of y= h(x) is a line segment joining the points (-7,-5) and (-1,-2) Drag the endpoints of the segment below to graph y=h^-1(x)

Answers

When we have an inverse function, the domain and range are switched.

All x-coordinates become y-coordinates and vice-versa.

So, if the point (-7, -5) is a solution of h(x), the point (-5, -7) is a solution of h^-1(x)

If the point (-1, -2) is a solution of h(x), the point (-2, -1) is a solution of h^-1(x).

Therefore, the endpoints of the segment that represents the inverse function are the points (-5, -7) and (-2, -1).

I have no idea how to solve this problem, could someone help me?△ABC∼△XYZ. Find the values of x and b (side lengths). 

Answers

The symbol ∼ denotes similarity, that is, the triangles ABC and XYZ are similar. When two triangles are similar, they have the same shape but not necessarily the same size and their corresponding angles are the same. In turn, the corresponding sides of two corresponding triangles are in the same ratio. Graphically,

[tex]\frac{a}{a^{\prime}}=\frac{b}{b^{\prime}}=\frac{c}{c^{\prime}}[/tex]

So to find x in the small triangle, you have

[tex]\begin{gathered} \frac{15}{10}=\frac{9}{x} \\ \text{ Multiply by x on both sides of the equation} \\ \frac{15}{10}\cdot x=\frac{9}{x}\cdot x \\ \frac{15}{10}x=9 \\ \text{ Multiply by }\frac{10}{15}\text{ on both sides of the equation} \\ \frac{10}{15}\cdot\frac{15}{10}x=9\cdot\frac{10}{15} \\ x=6 \end{gathered}[/tex]

Finally, to find b in the large triangle, you have

[tex]\begin{gathered} \frac{15}{10}=\frac{b}{8} \\ \text{ Multiply by 8 on both sides of the equation} \\ \frac{15}{10}\cdot8=\frac{b}{8}\cdot8 \\ 12=b \end{gathered}[/tex]

Therefore, the lengths of the sides x and b are

[tex]\begin{gathered} x=6 \\ b=12 \end{gathered}[/tex]

A rectangle is placed around a as shown below. The length of the rectangle is 16 ft. Find the area of the shaded region Use the value 3.14 for aand do not round your answer. Be sure to include the correct unit in your answer

Answers

The value of 16 ft is the diameter of the semicircle.

That means the radius is 8 ft, and this is also the measure of the smaller side of the rectangle.

First, let's calculate the area of the rectangle:

Now, let's calculate the area of the semicircle:

So the area of the shaded region is:

Explain in writing how the graph of the function h(x) = -|x-1| +4 is related to the graph of oneof the six basic functions. Sketch a graph of h(x). (6 points

Answers

Notice that the expression for h(x) uses an absolute value. The absolute value is the basic function related to h(x).

Recall the following function transformations:

Horizontal shift by c units:

[tex]f(x)\rightarrow f(x-c)[/tex]

Vertical shift by c units:

[tex]f(x)\rightarrow f(x)+c[/tex]

Reflection across the X axis:

[tex]f(x)\rightarrow-f(x)[/tex]

Starting with the absolute value function, notice that the function h can be obtained by applying a reflection across the X-axis, a horizontal shift by 1 unit and a vertical shift by 4 units:

[tex]undefined[/tex]

Which bot clicked more in one second

Answers

Answer:

Bot 4

Step-by-step explanation:

Here is one way

rate of bot 3    36 /5         in ten seconds    36/5 *10 = 72 clks

rate of bot4     26/3          in ten seconds    26/3 * 10 = ~ 87 clks

Which technique is most appropriate to use to solve each equation? Drag the name of the technique into the box to match each equation. Put responses in the correct input to answer the question. Select a response, navigate to the desired input and insert the response. Responses can be selected and inserted using the space bar, enter key, left mouse button or touchpad. Responses can also be moved by dragging with a mouse. (x+3)(x+2)=0 x² + 6 = 31

Answers

In (x+3)(x+2)=0, we use zero product property

And in [tex]x^{2}[/tex]+6=31, we use square root property

What is square root property and zero product property?

It is a property that can be used to solve the quadratic equations. It is used to solve an equation that can be put into one of the following two forms.

zero product property states the product of two non-zero elements is non-zero. The principle of zero-product property states that if there is any product of two numbers, that is equivalent to zero.

(x + 3) (x + 2) = 0

The most appropriate technique used to solve this equation is,

1.) zero product property

The solutions are:

(x + 3) = 0

x = -3

(x + 2) = 0

x = -2

x² + 6 = 31

The most appropriate technique used to solve this equation is,

2.) square root property

x² = 31-6

x² = 25

x = +/- root (25)

x = +/- 5

The solutions are:

x = 5, x=-5

To know more about square root property and zero product property, visit:

https://brainly.com/question/3164859

#SPJ1

A polygon is regular if each of its sides has the same length. Find the perimeter of the regular polygon.

Answers

Answer:

perimeter is 7.5 units

Step-by-step explanation:

the sides of the regular polygon are the same length , then

5x - 6 = 3)x - 1)

5x - 6 = 3x - 3 ( subtract 3x from both sides )

2x - 6 = - 3 ( add 6 to both sides )

2x = 3 ( divide both sides by 2 )

x = 3 ÷ 2 = 1.5

then length of one side is

5x - 6 = 5(1.5) - 6 = 7.5 - 6 = 1.5 units

then perimeter = 5 × 1.5 = 7.5 units

-6w + (-8.3) + 1.5 + (-7w)

Answers

Answer:

−13w − 6.8

Step-by-step explanation:

Let's simplify step-by-step.

−6w − 8.3 + 1.5 − 7w

−6w + −8.3 + 1.5 + −7w

Combine Like Terms:

−6w + −8.3 + 1.5 + −7w

(−6w + −7w) + (−8.3 + 1.5)

−13w + −6.8

The answer is -13w+9.8

What are like and unlike terms in an expression?

In Algebra, the like terms are defined as the terms that contain the same variable which is raised to the same power. In algebraic like terms, only the numerical coefficients can vary. We can combine the like terms to simplify the algebraic expressions.

Given here: -6w + (-8.3) + 1.5 + (-7w) = -13w+9.8

Hence, The answer is -13w+9.8

Learn more about like and unlike terms here:

https://brainly.com/question/29078851

#SPJ2

Translate nine times the difference of 5 and y in algebraic expressions

Answers

9(5 - y)

EXPLANATION

Difference means subtraction.

This implies that the difference of 5 and y can be expressed as 5 - y.

Hence, nine times the difference of 5 and y can be represented as:

9(5 - y)

Richard says that the rule (x,y)--> (0.2x,y) describes a horizontal stretch because only the x-coordinates are affected by the real. Is Richard correct? Why or why not?

Answers

Although it is true that only the x-axis is affected, that is, on the horizontal, when multiplying by a number less than 1, there would not be a stretch but a narrowing.

That is, the horizontal part would be smaller, which contradicts what Richard says.

help meeeeeeeeeeeeee pleaseeeeeeeeeee rn rnnnn!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
help meeeeeeeeeeeeee pleaseeeeeeeeeee rn rnnnn!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
help meeeeeeeeeeeeee pleaseeeeeeeeeee rn rnnnn!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

Answers

The rocket arrives at its most extreme level at 1.5 seconds after send-off will be 39 feet.

What is differentiation?

The rate of change of a function with respect to the variable is called differentiation. It can be increasing or decreasing.

A toy rocket is shot upward up high from a take-off platform 3 feet over the ground with an underlying speed of 48 feet each second. The level h, in feet, of the rocket over the ground at t seconds after send-off is given by the capability h(t) = - 16t² + 48t + 3.

Differentiate the function and put it equal to zero.

h'(t) = 0

-32t + 48 = 0

32t = 48

t = 1.5 seconds

Then the maximum height is given as,

h(1.5) = - 16(1.5)² + 48(1.5) + 3

h(1.5) = 39 feet

The rocket reaches its maximum height at 1.5 seconds after launch will be 39 feet.

More about the differentiation link is given below.

https://brainly.com/question/24062595

#SPJ1

What is the sufragerie area of this shape?
1cm
5cm
4cm
6cm
3cm
2cm

Answers

Answer:

I think the answer would be 88

You flip a coin and then spin this spinner. a) Determine whether these events are Independent or Dependent. Write I on D b) Find the probability that the coin lands tails-up and the spinner Yands on a I Write as a reduced fraction (numerator/denominator). 1

Answers

SOLUTION

Dependent events influence the probability of other events or their probability of occurring is affected by other events. Independent events do not affect one another and do not increase or decrease the probability of another event happening.

PART A

Since the flip of a coin would not affect the spin of the spinner, therefore these events are independent events.

The answer is 'I'

PART B

To find the probability that the coin lands tails-up and the spinner lands on 1, we would need to find the probability of getting a tail, then we find the probability of getting a 1

Therefore,

[tex]\text{Probaility}=\frac{no\text{ of favourable outcomes}}{\text{Total possible outcomes}}[/tex]

When we flip a coin, the favourable outcome for a tail is 1 since a tail can only occur once in one flip. The total possible outcomes are 2, since we can have either a tail or head occurring in one flip.

Then,

[tex]Pr(\text{Tail)}=\frac{1}{2}[/tex]

When we spin the spinner, the favourable outcome for one is 1, since we have only one slot for one on the spinner. The total possible outcome is 4 since we have 4 different number

slots on the spinner.

Then,

[tex]Pr(1)=\frac{1}{4}[/tex]

To get the probability of getting a tail, then we find the probability of getting a 1 we multiply the probability of getting a one on the spinner and a tail on the flip.

[tex]undefined[/tex]

Please help! I need explanation on why the answer is what it is.

Answers

The graph that matches the given linear inequality is (B) .

In the question ,

it is given that

the linear inequality is y [tex]>[/tex] -x + 4

on rewriting the inequality

we get

x + y [tex]>[/tex] 4

to plot the inequality , we need points to plot .

So ,when x = 0 , we have y = 4

and when y = 0 , we have x = 4

so the two points are (0,4) and (4,0) .

For shading the inequality , we put x = 0 and y = 0 ,

and get 0+0 > 4

0>4 , the result is False , So , the shaded region will be away from the origin which is shown in option (b) .

Therefore , The graph that matches the given linear inequality is (B) .

Learn more about Inequalities here

https://brainly.com/question/26591602

#SPJ1

Circle describe and correct each error.Graph x+2y= -2X-int = (-2,0)Y-int = (0,-4)

Answers

Explanation

We must graph the line with the equation:

[tex]\begin{gathered} x+2y=-2, \\ 2y=-x-2, \\ y=-\frac{1}{2}x-1. \end{gathered}[/tex]

Plotting this line, we get the following graph:

From the graph, we see that:

• the x-intercept is (-2, 0),

,

• the y-intercept is (0, -1).

Answer

• The x-intercept is ,(-2,0) ✓

,

• The y-intercept is not (0, -4) ,✖,, the correct y-intercept is ,(0, -1), ,✓,.

3. Jose began the day with eight Magikarps. After spending the day at the lake, he ended up with sixteen Magikarps.

Answers

We can find the percentage of increase in the number of Magikarps that Jose captured in the lake by taking the initial number of them and subtracting it from the number that he had by the end of the day, like this:

16 - 8 = 8

Now, we just have to divide 8 by 16 and then multiply by 100, like this:

[tex]\frac{8}{16}\times100=50[/tex]

Then, his number of Magikarps increased a 50%

(2)/(3)x-1=9-(1)/(6)x

Answers

For the given equation the value of x is, x = 12.

What is solving an equation?

Finding an equation's solutions, which are values (numbers, functions, sets, etc.) that satisfy the equation's condition and often consist of two expressions connected by an equals sign, is known as solving an equation in mathematics. One or more variables are identified as unknowns when looking for a solution.

Consider, the given equation[tex]\frac{2}{3}x - 1=9-\frac{1}{6}x[/tex]

Add 1 on both sides,

[tex]\frac{2}{3}x -1+1 = 9-\frac{1}{6}x+1\\ \frac{2}{3}x=10-\frac{1}{6}x[/tex]

Add 1/6(x) to both sides,

[tex]\frac{2}{3}x + \frac{1}{6}x = 10 - \frac{1}{6}x+\frac{1}{6}x\\ \frac{5}{6}x = 10[/tex]

Multiply both sides by 6/5

[tex]\frac{5}{6}x (\frac{6}{5}) = 10(\frac{6}{5}) \\ x = 12[/tex]

Hence, the value of x is, x = 12.

To know more about solving an equation, click on the link

https://brainly.com/question/22688504

#SPJ1

Calculate how much each should receive from the winningsA) Erin’s $ B) Kim’s $ C) Megan’s $

Answers

SOLUTION

Given the question in the image, the following are the solution steps to answer the question.

STEP 1: Write the given ratios

[tex]\begin{gathered} Erin=\frac{3}{7} \\ \\ Kim=5 \\ \\ Megan=\frac{1}{3} \end{gathered}[/tex]

STEP 2: Add the ratios

[tex]\begin{gathered} \frac{3}{7}+5+\frac{1}{3} \\ =\frac{3}{7}+\frac{5}{1}+\frac{1}{3} \\ =\frac{9}{21}+\frac{105}{21}+\frac{7}{21} \\ =\frac{9+105+7}{21} \\ =\frac{121}{21} \end{gathered}[/tex]

STEP 3: Calculate the earnings of each of them

Erin's

[tex]\begin{gathered} \frac{Erin^{\prime}s\text{ ratio}}{Total\text{ ratio}}\cdot Total\text{ winnings} \\ \\ By\text{ substitution,} \\ \frac{\frac{3}{7}}{\frac{121}{21}}\cdot14780=\frac{3}{7}\cdot\frac{21}{121}\cdot14780=\frac{133020}{121}=\:1099.33884\approx\text{ \$}1099.34 \end{gathered}[/tex]

Kim's

[tex]\begin{gathered} \frac{5}{\frac{121}{21}}\cdot14780 \\ =5\div\frac{121}{21}\cdot14780=5\cdot\frac{21}{121}\cdot14780=\frac{1551900}{121}=\:12825.61983\approx\text{ \$}12825.62 \end{gathered}[/tex]

Megans's

[tex]\begin{gathered} \frac{1}{3}\div\frac{121}{21}\cdot14780 \\ \frac{1}{3}\cdot\frac{21}{121}\cdot14780=\frac{103460}{121}=855.04132\approx\text{\$}855.04 \end{gathered}[/tex]

Hence, the earnings are given as:

Erin's: $1099.34

Kim's: $12825.62

Megan's: $855.04

help meeeeeeeeeeeeee pleaseeeeeeeeeee rn rnnnn!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
help meeeeeeeeeeeeee pleaseeeeeeeeeee rn rnnnn!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
help meeeeeeeeeeeeee pleaseeeeeeeeeee rn rnnnn!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

Answers

The area of a rectangle is the product of its length and breadth. The maximum area enclosed by the fence is 36800 square meter  and the dimensions of the enclosed area are 115 meter and 320 meter. The width is given as 115 meter.

What is a rectangle?

A rectangle is a kind of parallelogram that has equal diagonals.

All the interior angles of a rectangle are equal to the right angle.

The diagonals of a rectangle do not bisect each other.

The dimensions of the given rectangle is (650 - 2x) and x.

Then, the area of the given rectangle is A(x)  = x(650 - 2x)

In order to find the maximum area enclosed take the derivative of A(x) and equate it to zero as follows,

(660 - 2x) - 2x = 0

=> 4x = 660

=> x = 660 / 4

=> x = 115

Now, the maximum area is the value of A(x) at x = 115 as below,

= 115 × (650 - 2×115)

= 115 × 320

= 36800

The dimensions for the maximum area are 115 and (650 - 2 × 115) = 320.

Hence, the largest area enclosed is 36800 square meter and the dimensions of the enclosed area are 115 meter and 320 meter. The width is given as 115 meter.

To know more about rectangle click on,

https://brainly.com/question/25501702

#SPJ1

14x + 7 + 4 I need help asap

Answers

Answer:

Step-by-step explanation:

14x + 11

Pleaseeeeee helpppppp!
I will mark brainliest, but pls only if you know the answer
Its Geometry A

Answers

Answer:

see explanation

Step-by-step explanation:

A base angle

B leg

C vertex angle

D leg

E base angle

F base

in any isosceles triangle there are 2 congruent legs and 2 congruent base angles.

the base angles are opposite the congruent legs

the remaining side, the base is the 3rd side of the triangle

the vertex angle is formed by the 2 congruent legs

Use the graph of the polynomial function to find the factored form of the
related polynomial. Assume it has no constant factor.

Answers

The graph of the polynomial function shows the factored form of the

related polynomial, the factored form is (x+2)(x-2).

The factored from of a polynomial can be found from the zeros or x-intercepts of the graph.

The x-intercepts here are x= -2 and x= 2.

Then the factors are x+2 and x-2.

So the factored form is (x+2)(x-2).

Therefore, The graph of the polynomial function shows the factored form of the related polynomial, the factored form is (x+2)(x-2).

To  learn more about polymonials refer here

https://brainly.com/question/7693326

#SPJ9

Write –9.575 as a mixed number.

Answers

Hello the answer is -9 23/40

can anyone help??????

Answers

Answer:

140

Step-by-step explanation:

triangles equal to 180

64+76+x=180

x=40

180-40=140

Answer:

140°

Step-by-step explanation:

We know that,

  the exterior angle of a triangle is equal to the sum of the interior opposite angles of a triangle.

Accordingly,

k = 64 + 76

k = 140°

Other Questions
Find the measure of the angle between the two vectors.7) u = (6,-2)v = (8,-8)9) u =(2, 6)v = (-5, -8)8) u = (-2, 3)v = (4, -6)10) u = (-9, 4)v = (-7, -1) Roselle has three cups of popcorn and 6 oz of soda for a total of $246 calories. Carmel has one cup of popcorn and 14 oz of soda for a total of $274 calories. determine the number of calories per cup of popcorn and per ounce of soda A science fair poster is a rectangle 36 inches long and 24 inches wide what is the area of the poster in square feet with sure to include the correct unit in your answer when a weak acid react with a weak base. what's the result the basketball game had 600 people in attendance if the ratio of hawk fans to cyclone fans is 2:10 how many more cyclone fans were there 2. Yan also has three times as many apples as Xavier. Write a second expression for how many apples Yanhas. Find the sum of the interior angles of the shape. Use the remaining angles to solve for x. Polygons Help91120899Sum of interior angles =degreesX =degrees Write a program that asks the user to enter a city name, and then prints Oh! CITY is a cool spot. Your program should repeat these steps until the user inputs Nope.Sample RunPlease enter a city name: (Nope to end) San AntonioOh! San Antonio is a cool spot.Please enter a city name: (Nope to end) Los AngelesOh! Los Angeles is a cool spot.Please enter a city name: (Nope to end) PortlandOh! Portland is a cool spot.Please enter a city name: (Nope to end) MiamiOh! Miami is a cool spot.Please enter a city name: (Nope to end) Nope What is numeral value of 3/4 + 5/8 A cylinder shaped above ground pool is 4.5 deep. If the diameter of the pool is 16 ft, determine the capacity of the swimming pool in cubic feet. Write your awnser in terms of pi 6. 6.5 ounces g7.45 miles km8.2.3 miles cmCovert #6#7#8 How many electrons can be held in a sublevel l = 3? A gas occupies 12.3 L at a pressure of 40 mmHg. What is the volume when the pressure is increases to 60 mmHg? Which of the following notations correctly describe the end behavior of the polynomial graph below? Write an inequality for the word problem and answer the question about the inequality. Eric has an equal number of dimes and quarters that total less than 4 dollars. Could he have 12 dimes The question is in the picture. Using the answer choice word bank, fill in the proportion to find the volume of the larger figure. Why is the population of the Manufacturing Belt shrinking while the population of the Sunbelt is growing? The restriction enzyme EcoR1 recognizes the DNA sequence GAATTC. Which DNA strands will be cut byEcoR1?i. TTCAGGAATTCGGAAACCAAGTCCTTAAGCCTTTGGii. TGAATCGAACCTGACTTAGCTTGGACiii. TTAAGCGGCCGAATTCAGTCCAAATTCGCCCGCTTAAGTCAGGTiv. CAGTAGGATTTCTGTGTCGTCATCCTAAAGACACAG 30 POINTS PLS HELPBecause it is so popular, a store owner increases the cost of a toy by $4.99. The new cost of the toy is $14.84. (a)Write an equation that represents the situation. Use c to represent the original cost of the toy. (b)Solve the equation using a related equation. Show your work.(c)What does the solution of the equation represent? Can someone help me on this Im confused